ID: 955932632

View in Genome Browser
Species Human (GRCh38)
Location 3:64072950-64072972
Sequence TAGTTCAGCTGTTCTATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955932626_955932632 18 Left 955932626 3:64072909-64072931 CCTCCTTTATTCTTATACAGAAT No data
Right 955932632 3:64072950-64072972 TAGTTCAGCTGTTCTATGCTGGG No data
955932625_955932632 27 Left 955932625 3:64072900-64072922 CCTTTTTTTCCTCCTTTATTCTT No data
Right 955932632 3:64072950-64072972 TAGTTCAGCTGTTCTATGCTGGG No data
955932627_955932632 15 Left 955932627 3:64072912-64072934 CCTTTATTCTTATACAGAATGAA No data
Right 955932632 3:64072950-64072972 TAGTTCAGCTGTTCTATGCTGGG No data
955932624_955932632 28 Left 955932624 3:64072899-64072921 CCCTTTTTTTCCTCCTTTATTCT No data
Right 955932632 3:64072950-64072972 TAGTTCAGCTGTTCTATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955932632 Original CRISPR TAGTTCAGCTGTTCTATGCT GGG Intergenic
No off target data available for this crispr