ID: 955936107

View in Genome Browser
Species Human (GRCh38)
Location 3:64104151-64104173
Sequence CAGAGTAAGCAAGCGATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955936107 Original CRISPR CAGAGTAAGCAAGCGATTGG AGG (reversed) Intronic
903186253 1:21630993-21631015 CAGAGGAAGAAGGGGATTGGAGG - Intronic
904431445 1:30467162-30467184 CAGAGCAAGCACGGGTTTGGGGG - Intergenic
906226658 1:44128405-44128427 AAGGGTAAGAAAGAGATTGGTGG - Intronic
907919661 1:58900661-58900683 CAGAGTAAGAAGGAGATTTGGGG + Intergenic
909175320 1:72350256-72350278 CATATTTAGAAAGCGATTGGAGG - Intergenic
911387252 1:97192797-97192819 CACAGTAAGCAAGAATTTGGAGG + Intronic
912376328 1:109212794-109212816 CAGAGAGACCAAGTGATTGGAGG - Intergenic
914229036 1:145747879-145747901 CAGAGTAAGCCAGGGATTTATGG + Intronic
915218331 1:154354628-154354650 CAGAGGAAGCAAGCCATTGATGG + Intergenic
919110906 1:193217547-193217569 CACAGCAAGCAAGCTCTTGGTGG - Intronic
919316693 1:195979748-195979770 CAGAGCAAGCAAGAGAGTGATGG - Intergenic
919362698 1:196614613-196614635 CAGTGTAGGTAAGTGATTGGTGG + Intergenic
1068155558 10:53193245-53193267 GAGAGTAAGCAAGGGAGAGGAGG - Intergenic
1068640107 10:59394722-59394744 AAGAGTAAGCAAGGGAAAGGTGG - Intergenic
1073425101 10:103451433-103451455 CAGAGGAAGCCAGGGAGTGGAGG + Intronic
1074061026 10:109965637-109965659 CAAAATAAACAAGCGACTGGAGG + Intergenic
1077644527 11:3911667-3911689 AAGAGTAAGCAAGCCAGGGGTGG - Intronic
1078441263 11:11370830-11370852 CAGAGAACACAAGCGAATGGAGG + Intronic
1078770873 11:14350402-14350424 GAGAGGAAGCAAGCCAGTGGGGG - Intronic
1079619701 11:22538507-22538529 CATTGTAAGTAAGGGATTGGTGG + Intergenic
1079913673 11:26341690-26341712 CAGAGCAAGGAAGCCAGTGGTGG + Intronic
1086445510 11:86866815-86866837 GAGAGGAAGCAAGAGATGGGTGG - Intronic
1086497978 11:87423518-87423540 CAGAGTAAGGAAGTAAATGGTGG - Intergenic
1088657419 11:112013953-112013975 GAGAGGAAGCAAGAGAGTGGAGG + Intronic
1096323233 12:50634058-50634080 CAGAATGAGCAAGAGATGGGAGG - Intronic
1098321038 12:69243700-69243722 GAGAGTCAGCAAGTGAGTGGTGG + Intronic
1103164178 12:118756089-118756111 CAGAGTAAGCAAGCAGAGGGTGG + Intergenic
1107339398 13:39389741-39389763 CAGAGAAAGCAAACTATTTGAGG + Intronic
1108936745 13:55891250-55891272 CACAGGATGCAAGCTATTGGTGG + Intergenic
1113132808 13:107056972-107056994 GAGAAAAAGCAAGAGATTGGTGG - Intergenic
1121672432 14:95723023-95723045 GAGAGGAAGCAAGAGATTGGGGG - Intergenic
1124695551 15:31861662-31861684 CAGAATAATCAAGAGATTTGGGG + Intronic
1127468163 15:59265324-59265346 TTGAGTAACCAAGGGATTGGTGG - Intronic
1127698500 15:61474563-61474585 CAGAGCAAGGAAGCGATAAGAGG + Intergenic
1130739721 15:86586161-86586183 GAGAGTAAGCAAGAGAGAGGGGG - Intronic
1137481474 16:48855368-48855390 CAGACAATGCAAGAGATTGGGGG - Intergenic
1140252070 16:73302964-73302986 CAGAGTATGCAAATGATTAGGGG + Intergenic
1141093001 16:81143226-81143248 GAGAGGAAGCAAGCCAGTGGGGG - Intergenic
1142183392 16:88682537-88682559 TAGAGTAAGAAAGGGATTGAGGG - Intronic
1144339512 17:14300613-14300635 CAGAGTAGGGAGGCGGTTGGAGG - Intergenic
1147738942 17:42659549-42659571 CAGAGTGAGCAAGCGAGCGCCGG + Exonic
1153597409 18:6741906-6741928 TAGAGGAATAAAGCGATTGGGGG - Intronic
1157267811 18:46243924-46243946 CTGAGTAAGGAAGTGATTAGTGG + Intronic
1158905843 18:62010976-62010998 CAAAGTAATGAAGCGATTGCTGG + Intergenic
1160225581 18:77008660-77008682 CAGAGGAAGCCAGGGCTTGGGGG - Intronic
1160597046 18:79982913-79982935 CACGGTAACCAAGCGCTTGGAGG + Intronic
930741584 2:54837304-54837326 CAGAGCAAGCTAGCAATAGGGGG - Intronic
939529660 2:143341663-143341685 CAGAGTAAGCAAGAAATTTTAGG - Intronic
942519792 2:176791411-176791433 CACAGTGAGTAAGCGAATGGCGG - Intergenic
944533780 2:200689873-200689895 CAGAGAGACCAAGTGATTGGAGG - Intergenic
1173550005 20:43926268-43926290 CAGAGAAAGCATGGGAGTGGGGG - Intronic
1174235563 20:49087939-49087961 CAGAATAAGAGAGCGACTGGGGG - Intronic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1179199156 21:39199235-39199257 CAGAGTCAGAAAGTGATTTGCGG - Exonic
1183743781 22:39681980-39682002 CAGACTCAGCAAGTCATTGGAGG + Intronic
949730668 3:7108924-7108946 CAGAGTTAGCATGCAATTGGAGG + Intronic
952598086 3:35043711-35043733 CAGAGTTAAAAAGTGATTGGAGG - Intergenic
952634990 3:35518381-35518403 CAGTGTAAGAGAGCGATTTGAGG - Intergenic
954457391 3:50607298-50607320 CAGGGCAGGCAAGCGAGTGGAGG + Exonic
955936107 3:64104151-64104173 CAGAGTAAGCAAGCGATTGGAGG - Intronic
956370582 3:68555300-68555322 CAGAGTAAGTAAGCCACTCGAGG + Intergenic
957638664 3:82819855-82819877 AGGAGTAAGCAAAAGATTGGTGG - Intergenic
960781749 3:121327315-121327337 CAGAGTAATCAACAGTTTGGTGG - Intronic
963018569 3:140849516-140849538 TAGAGGAAGGAAGCGATTGTAGG - Intergenic
963393861 3:144706204-144706226 CAGAGTAAGGAAGAGATGGTTGG + Intergenic
963538607 3:146559712-146559734 AGGAGTAAGGAAGCCATTGGTGG + Intergenic
967785632 3:193491170-193491192 AAGAGTAAGCAAGAGATATGAGG + Intronic
974353879 4:60786708-60786730 CAGAGTAAGGAACCCATAGGTGG + Intergenic
976662212 4:87551510-87551532 CAGAGTGAGTAAGTGAGTGGGGG - Intergenic
978818949 4:112942998-112943020 GAGAAGAAGCAAGCGATTGATGG - Intronic
988773382 5:34453448-34453470 CTGAATAAGTAAGGGATTGGGGG + Intergenic
988833329 5:35007937-35007959 GAGAGAAAGCAAGAGATTAGGGG - Intronic
989453424 5:41613634-41613656 CAAAGTAAGAAAGCCATTGGAGG - Intergenic
989619675 5:43371998-43372020 GAGAGGAAGCAAGAGAGTGGGGG + Intergenic
990848900 5:60178509-60178531 CAAAATAAACAAGGGATTGGAGG - Intronic
992914752 5:81436920-81436942 TAGAGTAAGAAAGTGATTAGAGG - Intronic
999894792 5:156020009-156020031 CAGAGGAAGCAAGGGCTTGGAGG - Intronic
1000571368 5:162917993-162918015 CATAATAAGCCAGCTATTGGTGG - Intergenic
1001845184 5:174916000-174916022 CAGTGTAAGCAACAGAATGGAGG - Intergenic
1002064268 5:176644256-176644278 CAGTGTAAGCAAAGGCTTGGAGG + Intronic
1002846641 6:952014-952036 CAGAGTAAGCCAGGGATCTGAGG + Intergenic
1011671193 6:89684674-89684696 CAGAGTGTGTGAGCGATTGGTGG - Intronic
1017350113 6:153430507-153430529 GAGAGGAAGCAAGAGAGTGGGGG - Intergenic
1017816280 6:158018829-158018851 CAGAAAAAGCAAGCGTTTGGAGG - Intronic
1018241893 6:161785066-161785088 TAGAGAAAGAAAGTGATTGGTGG + Intronic
1023358902 7:39395902-39395924 CAGTTTAAACAAGTGATTGGGGG - Intronic
1026414015 7:70158318-70158340 CTGTGTAAGCATGAGATTGGAGG + Intronic
1029712867 7:102309077-102309099 CAGAGTCTGCTGGCGATTGGAGG - Intronic
1031614422 7:123864418-123864440 AAGAGTTAGCAAGATATTGGAGG - Intronic
1031882690 7:127215033-127215055 CAGAGTAAACAAGCCATCAGTGG - Intronic
1039599182 8:38819956-38819978 CTGAGGAAGAAAGCAATTGGAGG + Exonic
1041541133 8:58986466-58986488 CAGAGTCAGGAAGTGATTGGAGG + Intronic
1042807460 8:72787001-72787023 CATAGTCAGCAAATGATTGGTGG - Intronic
1047188635 8:122657928-122657950 CAAAGAAAGCAGGCAATTGGTGG - Intergenic
1050672302 9:8011169-8011191 CAGAGAAAGCGAGAGACTGGGGG + Intergenic
1059846257 9:118280293-118280315 CAGAGTTAGCAAATGAATGGTGG - Intergenic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1186716826 X:12260823-12260845 CAGATTAAGCAAACGCGTGGAGG - Intronic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1187680210 X:21760089-21760111 CAGAGAATGCAAGGGAGTGGGGG - Intergenic
1190338382 X:49277141-49277163 CAGAGTAAGCGAGCGGGTGAGGG - Intronic
1191658116 X:63621698-63621720 CAGAGAAAGGAAGAGATGGGTGG - Intergenic
1194272220 X:91830342-91830364 CACAGTAAGCAAGCTGTTTGTGG + Intronic
1196116318 X:112003469-112003491 CAGAGCAAGGAAGTGATAGGAGG + Intronic
1198537542 X:137601199-137601221 GAGAGACAGCAAGCGACTGGGGG + Intergenic
1198700347 X:139390823-139390845 CAGAGTGAGCAAGAGTTTGAGGG + Intergenic