ID: 955936957

View in Genome Browser
Species Human (GRCh38)
Location 3:64111154-64111176
Sequence GGAATAATCATACAACCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955936955_955936957 -7 Left 955936955 3:64111138-64111160 CCTCATCTGTGAAATGGGAATAA 0: 29
1: 300
2: 1614
3: 4425
4: 9277
Right 955936957 3:64111154-64111176 GGAATAATCATACAACCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 149
955936951_955936957 17 Left 955936951 3:64111114-64111136 CCTGGACTCTTTTGTGCTCAGTT 0: 1
1: 0
2: 0
3: 17
4: 186
Right 955936957 3:64111154-64111176 GGAATAATCATACAACCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 149
955936954_955936957 -6 Left 955936954 3:64111137-64111159 CCCTCATCTGTGAAATGGGAATA 0: 4
1: 32
2: 180
3: 580
4: 1372
Right 955936957 3:64111154-64111176 GGAATAATCATACAACCTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955936957 Original CRISPR GGAATAATCATACAACCTAA GGG Intronic
911753226 1:101522816-101522838 GCAAGAAGCATACAATCTAACGG - Intergenic
912669430 1:111610631-111610653 CAAACAATGATACAACCTAAGGG - Intronic
913670091 1:121089149-121089171 GGAATAATGATACAATCTTAGGG - Intronic
914021856 1:143876546-143876568 GGAATAATGATACAATCTTAGGG - Intergenic
914660341 1:149784496-149784518 GGAATAATGATACAATCTTAGGG - Intronic
916949277 1:169762509-169762531 GGGATAATCTTACAATCCAAGGG - Intronic
918982491 1:191581329-191581351 AGAGTAAACAGACAACCTAAAGG - Intergenic
919617523 1:199826008-199826030 GTAATAAGCATACTACCTGATGG - Intergenic
919962184 1:202482682-202482704 AGAGTAAACAGACAACCTAAAGG - Intronic
920948315 1:210550150-210550172 GGAATAATCAAACAGCTTTAGGG - Intronic
922316364 1:224446183-224446205 GAAATAATTATACTACCAAATGG - Intronic
922417546 1:225435378-225435400 GGATTAATCTTAAAACTTAAAGG + Intergenic
924062544 1:240190144-240190166 GCAATAAGCAGAAAACCTAATGG + Intronic
1064197370 10:13256373-13256395 TAACTAATCAAACAACCTAATGG + Intergenic
1066453850 10:35555563-35555585 GGAATAATAGTACCACCTCATGG - Intronic
1068079234 10:52299169-52299191 TGAAAAATCATATAACTTAAAGG - Intergenic
1068356530 10:55916964-55916986 GGAGCCATCATACAACCAAAAGG + Intergenic
1068619410 10:59163451-59163473 GGAATAAACAGACAACCTACAGG - Intergenic
1069832207 10:71288229-71288251 GGCACAAACATACAACCCAAGGG - Intronic
1070085671 10:73234969-73234991 GTACTTACCATACAACCTAATGG + Intronic
1071538731 10:86459190-86459212 GGAATAATTTCACAACCTACAGG + Intronic
1087420486 11:97919067-97919089 GTAAGAATGATATAACCTAAGGG + Intergenic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1090308982 11:125717649-125717671 GCAATAAGAATACAACCTGATGG - Intergenic
1093983027 12:25496245-25496267 AGTATAAACATACAACCAAAAGG - Intronic
1095629741 12:44361573-44361595 TGAATAATCAAACAACCAAATGG + Intronic
1099559316 12:84152794-84152816 AGAGTAAACAGACAACCTAAAGG + Intergenic
1099577463 12:84399694-84399716 AGAGTAAAGATACAACCTAAAGG + Intergenic
1100382773 12:94077107-94077129 AGAATCATCATAATACCTAAAGG + Intergenic
1104244327 12:127023013-127023035 GGAATAATGATACCTCATAAGGG + Intergenic
1104520172 12:129466968-129466990 GGACTATTCATCCAACCAAAAGG - Intronic
1107263550 13:38524140-38524162 GGAGAAATTATACAACCAAATGG - Intergenic
1107582157 13:41802318-41802340 GGAATAATCATTCATCCCAGGGG + Intronic
1108205965 13:48090716-48090738 GGAAAAGTCATAAAAACTAAGGG + Intronic
1108616331 13:52137019-52137041 TGAATAATCATAGAACCCCAAGG + Intronic
1111247525 13:85560119-85560141 GGAATAATTATAGAACAAAATGG - Intergenic
1111497162 13:89067073-89067095 GGAATAATCATAATACCTCTAGG - Intergenic
1112643390 13:101302665-101302687 GTAATAATATTACAACTTAATGG + Intronic
1112735199 13:102408478-102408500 AGAATAAACAGACAACCTACGGG - Intergenic
1115229474 14:31143948-31143970 AAACTAATCATAAAACCTAAAGG + Intronic
1116289810 14:43019001-43019023 AGAATAATCACACAACTTAGCGG - Intergenic
1117500227 14:56344029-56344051 GGATTAATCATGTAACTTAATGG + Intergenic
1118651861 14:67904853-67904875 AGAATAAACAGATAACCTAAAGG - Intronic
1121424441 14:93839002-93839024 GCAATGATCATACAGACTAATGG + Intergenic
1121867336 14:97374796-97374818 GGATGAATCATACAACCAATAGG + Intergenic
1123806489 15:23879291-23879313 TGAATAATGATACAAGCTACAGG + Intergenic
1124575697 15:30906262-30906284 GGAACAACAAAACAACCTAATGG - Intronic
1127539697 15:59924760-59924782 GGAGATAACATACAACCTAAAGG + Intergenic
1129285516 15:74521464-74521486 AAAAGAATTATACAACCTAAAGG + Intergenic
1131203396 15:90420637-90420659 GCAATAATCATAGAATCTCAAGG - Intronic
1135825449 16:25723363-25723385 GAAAGAATCATACATGCTAAAGG - Intronic
1137858117 16:51817300-51817322 GTAATAAGCATAGTACCTAATGG + Intergenic
1140282259 16:73565637-73565659 GGACAAGTCACACAACCTAAGGG - Intergenic
1140636665 16:76922936-76922958 AGAATAAACAAACAACCTATAGG - Intergenic
1143883489 17:10048680-10048702 GAAATACTCATACAACTTGATGG - Intronic
1148517730 17:48237259-48237281 TGAATAATGATACAACTTTATGG - Intronic
1153424689 18:4949237-4949259 GGAATAAACATACAAAAGAATGG + Intergenic
1156258068 18:35417708-35417730 AGACTAATCATACAACCTGCTGG - Intergenic
1157740864 18:50091526-50091548 GGTATACTCAGAGAACCTAACGG + Intronic
1158317122 18:56223568-56223590 GGAATCAGCATACAAGCTGAGGG + Intergenic
1159532421 18:69671514-69671536 GGAATATTTATGCAACCTGAAGG - Intronic
1159648396 18:70947446-70947468 AAAATAATCATAAAAACTAAAGG + Intergenic
1165310697 19:35027948-35027970 GTAATAATAATACCACCTATAGG + Intergenic
929715905 2:44309495-44309517 GGAATAATGTTACAAACCAATGG + Intronic
931278827 2:60769569-60769591 GGAAGACTCAGAAAACCTAATGG + Intronic
933108092 2:78359189-78359211 TGAATCATCAGAAAACCTAAAGG - Intergenic
935313705 2:101810558-101810580 GGGAAAATCATAAAACCTGAGGG - Intronic
940502372 2:154509103-154509125 GGAATAATGAATTAACCTAAAGG - Intergenic
942627658 2:177919914-177919936 AGAATAATCATGCAACTTAAAGG + Intronic
946651640 2:221897783-221897805 GTAATAATCATACAGGCTCATGG - Intergenic
1171106388 20:22437227-22437249 GTAATAATCATACATACTTATGG + Intergenic
1171991703 20:31701537-31701559 GGAAAATTCATACAACCAAAAGG - Intronic
1172437508 20:34940063-34940085 GGAGTAATAATAATACCTAAAGG - Intronic
1176727951 21:10458604-10458626 GGAATACTGAAACAACCTTATGG - Intergenic
1179276239 21:39894180-39894202 GGAATTATTAGACAATCTAATGG + Intronic
1179517524 21:41918827-41918849 GGAAGAATCATAAAAACTTACGG + Intronic
1184480925 22:44746482-44746504 GGAATAATCATGCAAAATAAAGG - Intronic
1184822674 22:46921831-46921853 AGAGTAAACATACAACCTACAGG - Intronic
1202726535 2_KI270716v1_random:4939-4961 GGAATAATCATAAAATAGAATGG - Intergenic
952841241 3:37647244-37647266 AGAATACTCAGCCAACCTAATGG - Intronic
954984052 3:54774037-54774059 TGAATAATCATACAACATGATGG + Intronic
955936957 3:64111154-64111176 GGAATAATCATACAACCTAAGGG + Intronic
957172863 3:76761415-76761437 GGAATAATCACACAACAGGATGG - Intronic
957200798 3:77133628-77133650 GGAATAAATATAAAAACTAAAGG - Intronic
957672653 3:83325598-83325620 GGAAGCAGCATACAACTTAAAGG + Intergenic
959681711 3:109104097-109104119 AAAATAATCATGCAACATAAAGG + Intronic
960711106 3:120529138-120529160 GGAATAATCATCTTACCTGAAGG + Intergenic
962981367 3:140493451-140493473 GCATTAGTCATGCAACCTAAGGG + Intronic
963932588 3:151019497-151019519 GAAATGATCAAACAACCCAATGG - Intergenic
967082881 3:186066568-186066590 GGAATAATCAGGAAACCTATAGG + Intronic
969944289 4:10767065-10767087 GGAATCATCACACTATCTAACGG - Intergenic
970481792 4:16483550-16483572 GGAATAATTAAACAAGTTAACGG + Intergenic
970959393 4:21855465-21855487 AGAATAATTATACTACCTATGGG - Intronic
971742991 4:30544048-30544070 AGAATAATCATAGAAACAAATGG + Intergenic
972594804 4:40520160-40520182 GGAATTCTAATACAACCTACAGG - Intronic
973548594 4:52007636-52007658 TGAACAATCATCCAAACTAATGG - Intronic
976132103 4:81895754-81895776 GGATTAATTATACATGCTAAGGG + Intronic
978420020 4:108521931-108521953 GGAAAAATTATACTAACTAAAGG - Intergenic
978833536 4:113118152-113118174 GAAATAATCTTACAACTTGATGG + Intronic
979032050 4:115661855-115661877 AGAGTTATCATACAATCTAATGG - Intergenic
980431388 4:132702509-132702531 AGAAGAATCATACAAAATAAAGG - Intergenic
981466558 4:145079084-145079106 GGAGTAAACAGACAACCTACAGG + Intronic
981743732 4:148031389-148031411 GGGATAATAATACTACCTATAGG - Intronic
982807595 4:159786014-159786036 GCTATAATCATAAAACCAAAAGG + Intergenic
983328133 4:166286572-166286594 GCAATAAAAATAAAACCTAAAGG + Intergenic
984664189 4:182407955-182407977 GGAATAAACATAAAATCTCAAGG - Intronic
988341273 5:29975423-29975445 GTAATAATCATACATACTTACGG - Intergenic
992757197 5:79918939-79918961 AGAGTAAACAGACAACCTAATGG + Intergenic
993182340 5:84570432-84570454 GGAATAAGTATACTACTTAAGGG - Intergenic
993441406 5:87961332-87961354 GGAATAATGATATATTCTAATGG - Intergenic
993835264 5:92812087-92812109 GGAATAAGCTTACAATCTAGTGG - Intergenic
994173648 5:96686147-96686169 GGAATAATCAAAAGATCTAAAGG - Intronic
997069645 5:130606220-130606242 AACATAATCATACAACCAAAAGG + Intergenic
997397148 5:133571020-133571042 GGCATAATCATATAACTCAAGGG - Intronic
1000013299 5:157253947-157253969 GGAATAATAATATTACCTCATGG - Exonic
1002695108 5:181082380-181082402 GGAAGACTAATACTACCTAAAGG + Intergenic
1003512464 6:6792784-6792806 GAAATAACCAGTCAACCTAAGGG + Intergenic
1008282422 6:49612443-49612465 CCAATAATCATAGAACCAAATGG + Exonic
1008753057 6:54760056-54760078 GGAAAAATGATACAACTCAAAGG - Intergenic
1009965957 6:70578512-70578534 AGAGTAAACATACAACCTACAGG - Intronic
1011226336 6:85111681-85111703 GGAAGAATGATGCAACCTAGAGG - Intergenic
1014602739 6:123435053-123435075 GGCATAATAATACAATATAAGGG + Intronic
1014856553 6:126408753-126408775 TGAATAACCATACAACAAAATGG - Intergenic
1014856983 6:126414959-126414981 TGAATAACCATACAACAAAATGG + Intergenic
1021964354 7:25902883-25902905 TGAATAAACATCTAACCTAATGG + Intergenic
1026396625 7:69961881-69961903 AGAAAACTCATACAACCTCAAGG + Intronic
1026666990 7:72350069-72350091 GGCTTAAACATAAAACCTAAAGG - Intronic
1027294939 7:76760495-76760517 GGAAAAATCATGCAATTTAAAGG + Intergenic
1028318548 7:89434272-89434294 GGAATAAGCATACAGAGTAAAGG - Intergenic
1028625714 7:92874969-92874991 AGAGTCATCAGACAACCTAATGG - Intergenic
1030297703 7:107945541-107945563 GAAATTATCATCCAAGCTAAAGG - Intronic
1031389213 7:121192443-121192465 GGAAGAAATATACAACCTATAGG + Intronic
1034132168 7:148729556-148729578 GGAAAAATCATACAATCTCACGG - Intronic
1037525496 8:19720355-19720377 GGAATAATCATAAAGCCTGATGG + Intronic
1037525662 8:19721501-19721523 GGAATAATCATAAAGCCTGATGG + Intronic
1041537184 8:58939758-58939780 GGAAAAATAAAACCACCTAATGG - Intronic
1047359842 8:124159307-124159329 GGAAAAATTATATTACCTAATGG + Intergenic
1050588158 9:7134757-7134779 GAAATAATCATAGAATCTGAAGG + Intergenic
1052333536 9:27296434-27296456 GAAATGAAAATACAACCTAATGG + Intronic
1052344235 9:27392315-27392337 AGAATACTCTTACAACCTAGGGG - Intronic
1052404636 9:28044219-28044241 GGAGTAATGATACCACCTCAAGG + Intronic
1052793914 9:32904524-32904546 GGAAAAAGCACAAAACCTAATGG - Intergenic
1053949341 9:43351779-43351801 GGAATAATCATAAAATAGAAGGG - Intergenic
1055017212 9:71631803-71631825 GGAATAATCATATAATCCAGTGG - Intergenic
1055588436 9:77783095-77783117 CCATCAATCATACAACCTAAAGG + Intronic
1056146468 9:83735895-83735917 GCAATGTTCATACAACCTCATGG + Intergenic
1059257854 9:112947118-112947140 GGAATAAAAATAATACCTAATGG - Intergenic
1203592521 Un_KI270747v1:79980-80002 GGAATAATCATAAAATAGAAGGG - Intergenic
1186403699 X:9283181-9283203 GGCAAAATCATACAACTTCAGGG - Intergenic
1186717018 X:12263116-12263138 GTAATGAGCAAACAACCTAAGGG + Intronic
1189634378 X:42989840-42989862 GACATAATTATAGAACCTAATGG + Intergenic
1193006473 X:76624865-76624887 AGAATAAACAGACAACCTACAGG + Intergenic
1193392445 X:80944895-80944917 TGAATAAACATACAGACTAATGG - Intergenic
1194107381 X:89787733-89787755 GCAATAAGCATACTACCCAATGG + Intergenic
1195493577 X:105503122-105503144 GTACTAATCATACAATCTTAAGG - Intronic
1195500251 X:105589325-105589347 AGAATAAACAGACAACCTACAGG - Intronic
1196233905 X:113256847-113256869 AGAATAAACAAACAACCTACAGG - Intergenic
1197305883 X:124841671-124841693 GGAATCAGCATACCACCTACTGG + Intronic
1198621997 X:138522819-138522841 GGAAGAATCCTAGAAGCTAAAGG + Intergenic
1200459340 Y:3435540-3435562 GCAATAAGCATACTACCCAATGG + Intergenic
1202297323 Y:23373597-23373619 AGAGTAAACAGACAACCTAAAGG - Intergenic
1202573484 Y:26297000-26297022 AGAGTAAACAGACAACCTAAAGG + Intergenic