ID: 955941696

View in Genome Browser
Species Human (GRCh38)
Location 3:64152164-64152186
Sequence CCCATTTTGCCCCACTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955941696_955941702 26 Left 955941696 3:64152164-64152186 CCTTTTAAGTGGGGCAAAATGGG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 955941702 3:64152213-64152235 CCTCACTCTAGGTAAGAAATCGG 0: 1
1: 0
2: 0
3: 9
4: 113
955941696_955941700 15 Left 955941696 3:64152164-64152186 CCTTTTAAGTGGGGCAAAATGGG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 955941700 3:64152202-64152224 TCTCTGTATCTCCTCACTCTAGG 0: 1
1: 0
2: 2
3: 29
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955941696 Original CRISPR CCCATTTTGCCCCACTTAAA AGG (reversed) Intronic
900710313 1:4109229-4109251 CTCCTTGTGCCCCAGTTAAATGG + Intergenic
901554505 1:10020940-10020962 CCCTTTTTCCCCCCCTTTAAGGG - Intergenic
904295924 1:29519685-29519707 CCCATATTTCCCCATTTAATTGG - Intergenic
907916686 1:58876458-58876480 CCCATTGTGTATCACTTAAATGG - Intergenic
909539037 1:76770472-76770494 CCCATTTGTCCCCACTTATTTGG + Intergenic
914979077 1:152396872-152396894 ATCATTTTACCCCAGTTAAAAGG + Intergenic
917020377 1:170580237-170580259 TCCATTTTGCCTCTCTTTAAAGG - Intergenic
919551764 1:198999311-198999333 CGCATTTTGCCAAAATTAAATGG + Intergenic
920853109 1:209642352-209642374 CCCATTTTGACCTACAAAAATGG + Intronic
921115805 1:212089937-212089959 TACACTTTGACCCACTTAAATGG + Intronic
922886168 1:229022667-229022689 CTCATTTTCCCCAACTTAAGTGG - Intergenic
1064002247 10:11673337-11673359 CCCAATATGCCCCACTTCAATGG + Intergenic
1067676868 10:48388515-48388537 CCCATTTTTATCCTCTTAAAGGG - Intronic
1069257773 10:66355297-66355319 CCCAATGTGACCCAGTTAAATGG - Intronic
1071845291 10:89515492-89515514 TCCATTTTGCCTCACTTTACAGG + Intronic
1071992102 10:91109534-91109556 ACCATTTTGTAGCACTTAAATGG - Intergenic
1075520850 10:123142808-123142830 TCCATTTTGCCCCATTTACTCGG + Intergenic
1075991419 10:126841972-126841994 CCCAAAGTGCCCCACTTGAAGGG + Intergenic
1076345927 10:129778961-129778983 CCTATTTTCAGCCACTTAAAGGG + Intergenic
1076759877 10:132598228-132598250 CCCATTTTACCGCATTAAAAAGG - Intronic
1077455567 11:2676894-2676916 CCCAGTGTGCACCACTTAAAAGG + Intronic
1078288160 11:9979166-9979188 GCCAATTAGCCCCACTAAAATGG + Intronic
1080813652 11:35731944-35731966 CCCATTTTGCGCCATTTATAAGG + Intronic
1081345734 11:41983361-41983383 CTCATATTTCCCCACATAAATGG + Intergenic
1081415402 11:42808960-42808982 CCTTTTTTTCCTCACTTAAAAGG + Intergenic
1084476326 11:69391680-69391702 CCAATTGTCCCCCTCTTAAAAGG + Intergenic
1087716446 11:101613978-101614000 CCTATTTTGTGCCAATTAAATGG - Intronic
1091832054 12:3556951-3556973 CCCACTTTCCCCCACTTCTATGG - Intronic
1097316761 12:58180073-58180095 CCCATTTTACCCACCTTTAATGG - Intergenic
1097358234 12:58626823-58626845 CCTAGTTTCCCCCACTTAATGGG - Intronic
1099759209 12:86895723-86895745 GCCCTAATGCCCCACTTAAAAGG + Intergenic
1099918887 12:88932419-88932441 CCCTTTTTTCTCCACTCAAATGG + Intergenic
1106219084 13:27730023-27730045 TGCATTTTGACCCACATAAAGGG - Intergenic
1109885235 13:68533057-68533079 TCCATTTTCCCCCAATTGAAAGG - Intergenic
1114764612 14:25356675-25356697 GCCATTTTGTCCCACCTAATGGG + Intergenic
1114950582 14:27747078-27747100 CACATCTTGTCCCACTGAAAAGG + Intergenic
1121254580 14:92521747-92521769 TCCATTTTGCCTCACTATAAAGG - Intronic
1123408733 15:20041060-20041082 CCCATTTCTCCCAACTGAAATGG + Intergenic
1123518064 15:21047770-21047792 CCCATTTCTCCCAACTGAAATGG + Intergenic
1126681679 15:51208294-51208316 CCCATTTTCCCCCTCTCAAGTGG - Exonic
1128298969 15:66551987-66552009 CACATTTTGTCTCAGTTAAACGG + Intronic
1130221051 15:82020070-82020092 CCTTTTTTCCCCCACTAAAAGGG - Intergenic
1131919579 15:97309628-97309650 GCCATTTGGCCCCACCTAAGAGG - Intergenic
1138235040 16:55374931-55374953 CCCAGTGTGTCCCACTGAAAGGG - Intergenic
1147342806 17:39764674-39764696 CCCTTTTTTTCCCATTTAAATGG - Intergenic
1149186225 17:54001028-54001050 CACATTTCACCCTACTTAAATGG - Intergenic
1157387881 18:47274857-47274879 CTCATTTTCCTCCAGTTAAAGGG - Intergenic
1164948275 19:32314470-32314492 CCCATTCCGCCCCAGTTAACAGG - Intergenic
1166008656 19:39925287-39925309 CCCATTTTTGCCCATTTTAAAGG + Intronic
924974909 2:163746-163768 CACATTTTCCCCCAATGAAATGG + Intergenic
934163203 2:89271817-89271839 CCCATTCTGCTCCACTGAGAAGG + Intergenic
934204070 2:89910707-89910729 CCCATTCTGCTCCACTGAGAAGG - Intergenic
934486758 2:94722406-94722428 CACATCTTGTCCCACTGAAAAGG - Intergenic
938059729 2:128243072-128243094 GCTATTCTGCCCCACTTAAGGGG + Intronic
938276875 2:130034309-130034331 CCCATTTTGCCCCGGTTGCAGGG + Intergenic
939758368 2:146141910-146141932 CTAATTTTGCCCCACTGACAAGG + Intergenic
940982672 2:160020883-160020905 CACATTCTGCCTCACTTATAAGG - Intronic
943792575 2:191950719-191950741 CCCATTTTATCTCACTTTAAAGG + Intronic
944654042 2:201860076-201860098 CTCCTTTTGCTCCACTGAAAGGG + Intronic
948188822 2:236042936-236042958 CCCTGTGGGCCCCACTTAAAGGG + Intronic
948592867 2:239062657-239062679 CCCTTTTTGCTCCAGTTAAAAGG - Intronic
1168988104 20:2068198-2068220 GCCATCTTGTCCCACTTAAGGGG + Intergenic
1172914176 20:38431506-38431528 TCCATCTTGTCCCACATAAACGG + Intergenic
1175743618 20:61437710-61437732 TCCATTGTACTCCACTTAAAAGG + Intronic
1177895149 21:26847780-26847802 CCCTTTTTGCCCCAATTTAAGGG - Intergenic
1177963801 21:27702190-27702212 CCAATTTTGAACCACCTAAATGG - Intergenic
1179298876 21:40089169-40089191 CCCATTTTGCCCATTTTAGACGG + Intronic
1184761164 22:46545382-46545404 CCCTTTTTTCTCCACTCAAAAGG - Intergenic
951699277 3:25478521-25478543 CCCATCTTGCCCTACTTCAGGGG + Intronic
952032679 3:29163076-29163098 CCCATATCACCCCACATAAAGGG - Intergenic
955941696 3:64152164-64152186 CCCATTTTGCCCCACTTAAAAGG - Intronic
955951191 3:64243887-64243909 CTCATTTTACCCCAATAAAATGG + Intronic
955989693 3:64613166-64613188 ACCATTTTGCCCCCCTTCCAAGG - Intronic
958144172 3:89602395-89602417 CTTCTTCTGCCCCACTTAAAGGG - Intergenic
959492777 3:107011554-107011576 CCCATGTTGCCACACTTGACAGG - Intergenic
963752389 3:149196374-149196396 CCCATTTTCTTCCACTGAAAAGG + Intronic
964291282 3:155183506-155183528 AAGGTTTTGCCCCACTTAAATGG - Exonic
964830077 3:160874455-160874477 TCCATTTTGGCAGACTTAAAGGG - Intronic
964922396 3:161913110-161913132 CCCATTTTTTTCAACTTAAAGGG + Intergenic
968725349 4:2245386-2245408 CCCATTCCTCCCCACTTCAAAGG - Intergenic
970909229 4:21255129-21255151 CCCATTTTGCCCAACTATAGAGG + Intronic
971795942 4:31228622-31228644 CCCAAAATGCCCCATTTAAAAGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
979234560 4:118385264-118385286 CCCATTTTGCATCACTATAAAGG - Intergenic
979970650 4:127130618-127130640 CCCATATTGGCCCAGTTATAGGG - Intergenic
982202192 4:152971913-152971935 TCAATTTTGCCCCACTGAGAGGG - Intronic
985182672 4:187281937-187281959 CCCCATTTGCTCCACTTACATGG - Intergenic
987048014 5:14125502-14125524 CCCATTTTTCTCCTCTTCAAAGG - Intergenic
987736817 5:21856781-21856803 CCCACTTTGTGCTACTTAAAAGG + Intronic
992476419 5:77106411-77106433 CCCCTTTTCCCCCATTGAAATGG + Intergenic
993003441 5:82405828-82405850 CCGATTTTGCCCAACCTAGAGGG - Intergenic
1004465617 6:15882372-15882394 CACTTTTTTCCCCCCTTAAAAGG + Intergenic
1006562197 6:34923206-34923228 CTCACTTTTCCCCACTTTAATGG - Intronic
1011356605 6:86478247-86478269 CTAATTTTGTCCCACCTAAATGG - Intergenic
1014733392 6:125061481-125061503 CCCAATCTGTCCCACATAAATGG - Intronic
1016177773 6:141101027-141101049 CCCATTTCTCCCCTTTTAAAAGG + Intergenic
1016561300 6:145397694-145397716 TCCATTTAGCCCCATTGAAAAGG + Intergenic
1016701948 6:147064341-147064363 CCCACAAAGCCCCACTTAAAAGG + Intergenic
1017726417 6:157279049-157279071 CCCATTTTTCCCTTCTAAAAGGG + Intergenic
1019568527 7:1696976-1696998 CCCAGCCTGCCCCACTGAAAGGG - Intronic
1021846645 7:24769535-24769557 GCCATTCTGCCCCACATAATGGG + Intergenic
1023590004 7:41771730-41771752 CTCATCTTGCCCCACTTAGAAGG + Intergenic
1023730513 7:43187328-43187350 CCCAATTTCCTCCACTTGAAAGG - Intronic
1030166522 7:106561130-106561152 CCCTTTCTCTCCCACTTAAAAGG - Intergenic
1031939607 7:127774187-127774209 CACATCTTGTCCCACTTAGAAGG - Intronic
1033269773 7:139920279-139920301 CCCCTTCTGCCCCTCTTCAAAGG - Intronic
1035761662 8:2073106-2073128 CCCACTTTGACCCACTCAAGTGG + Intronic
1038851860 8:31286547-31286569 TCCTTATTGCCCCACTTAATAGG + Intergenic
1039086377 8:33783905-33783927 CCCCTTCTGCATCACTTAAAGGG + Intergenic
1042778236 8:72459904-72459926 GCCATTCTGCCCCACTTAAAGGG - Intergenic
1043229687 8:77786419-77786441 AACATTTAGCCCCAGTTAAAAGG - Intergenic
1044928060 8:97225818-97225840 CCCAGTGTGGCCCACTAAAAAGG - Intergenic
1046443968 8:114291139-114291161 GCCATTGTGTCCCACCTAAAGGG - Intergenic
1051158449 9:14177592-14177614 CACATTATACCCAACTTAAATGG - Intronic
1052948294 9:34186043-34186065 GCCATTTTGCCCCTCTTAGGTGG + Intronic
1053671037 9:40361890-40361912 CACATCTTGTCCCACTGAAAAGG + Intergenic
1053920841 9:42988251-42988273 CACATCTTGTCCCACTGAAAAGG + Intergenic
1054382154 9:64501950-64501972 CACATCTTGTCCCACTGAAAAGG + Intergenic
1054513576 9:66014409-66014431 CACATCTTGTCCCACTGAAAAGG - Intergenic
1055503499 9:76925135-76925157 CCCATTTTGACCCAGTTAAGAGG - Intergenic
1056593856 9:87988990-87989012 TCCATTTTGCACCACTATAAAGG + Intergenic
1057668035 9:97061797-97061819 TCCATTTTTCCCTGCTTAAAGGG - Intergenic
1062571011 9:137185398-137185420 CACACTTGCCCCCACTTAAATGG + Intronic
1186271892 X:7897491-7897513 CCCATTTTGACTGACTTAGAGGG - Intergenic
1186455537 X:9707459-9707481 CACATTAAGACCCACTTAAAGGG - Intronic
1191004331 X:55694935-55694957 GCCATCTTGCCCCACCTAAAGGG - Intergenic
1192920319 X:75699096-75699118 GCTAATTGGCCCCACTTAAAAGG + Intergenic
1194595828 X:95856174-95856196 ATCATCTTGCCCCAGTTAAAAGG + Intergenic
1200766248 Y:7083174-7083196 CACAGTATGACCCACTTAAAGGG - Intronic
1200846654 Y:7837544-7837566 CTAATTTTGTCCCACCTAAATGG - Intergenic