ID: 955942658

View in Genome Browser
Species Human (GRCh38)
Location 3:64161080-64161102
Sequence ACTTTTAAGTAGGAGCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955942658 Original CRISPR ACTTTTAAGTAGGAGCGTCA GGG (reversed) Intronic
902060387 1:13636935-13636957 ACTCTTATGTAAGAGAGTCATGG - Intergenic
904907550 1:33909314-33909336 ACTTTTGAGAAGGAGCCACAGGG - Intronic
905473839 1:38212097-38212119 ACTTTTAAATGGGACAGTCAAGG - Intergenic
905713643 1:40129330-40129352 AATTTTAAATAGGATGGTCAAGG + Intergenic
908208195 1:61872701-61872723 ACCTTAAAGCAGGAGCGTAAGGG - Intronic
910241112 1:85087125-85087147 GCTTTTATATAGGAGTGTCAGGG - Intronic
910770427 1:90825385-90825407 ATATTTAAGCAGGAGCATCATGG - Intergenic
911542310 1:99172458-99172480 ACTTATAAGTAGGAGCTAAATGG - Intergenic
915643363 1:157247584-157247606 AGTTTTAAATAGGATGGTCAGGG - Intergenic
917839097 1:178963173-178963195 AGTTTTAAATAGGATGGTCAGGG + Intergenic
918031292 1:180814772-180814794 ACTTTTAAATGAGAGCATCAGGG + Intronic
918611080 1:186493016-186493038 TCTTTTCAGTAGGAATGTCAAGG + Intergenic
919524791 1:198633985-198634007 TCTTTTATGTAGGATGGTCAGGG + Intergenic
922426037 1:225494703-225494725 ACTTTTAAGTAGTAAAGTCTTGG + Exonic
923376944 1:233373509-233373531 ACTTCTGAGAAGGAGCGCCAAGG - Intronic
924840350 1:247703910-247703932 ACTTTTAAGTGGGAGCTAAATGG - Intergenic
1069249801 10:66254449-66254471 ACTTTAAAGTGGGAGCTTAAGGG - Intronic
1070115973 10:73529225-73529247 ACTTATAAGTGGGAGCTACATGG + Intronic
1071414443 10:85428070-85428092 ACATTTAAACAGGAGCTTCAAGG + Intergenic
1071530678 10:86388638-86388660 AGTTTTAAGTAGGATGGTCTGGG - Intergenic
1077988134 11:7375965-7375987 AATTTTAAGCAGGATGGTCAGGG - Intronic
1083884015 11:65562212-65562234 TATTTTAAGGAGGAGAGTCATGG - Intergenic
1086805046 11:91230716-91230738 GCTTTGAAGTAAGAGTGTCAGGG - Intergenic
1087612486 11:100451560-100451582 AGTTTTAAGTAGGGTGGTCAGGG + Intergenic
1088739996 11:112759444-112759466 ACTTTTAAGCAGAAGAGTAAGGG + Intergenic
1089064881 11:115655222-115655244 AGTTTTAAGTAGGGAGGTCATGG + Intergenic
1089810019 11:121124033-121124055 AATTTTAAATAGGATGGTCAGGG - Intronic
1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1098064208 12:66594888-66594910 ACTTTTAAGTAAGACAGTAAGGG + Intronic
1100027862 12:90151743-90151765 ACTATTAAGTATGTGCGTCCTGG + Intergenic
1101410993 12:104468178-104468200 AATTTTAAATAGGATTGTCAGGG + Intronic
1101920156 12:108925857-108925879 AGTTTTAAATAGGATGGTCAGGG - Intronic
1108550723 13:51541102-51541124 AACTTTAAGTAGGATGGTCAGGG + Intergenic
1110005664 13:70264348-70264370 ACTTTAAAGTAGGAGCATAGGGG - Intergenic
1110432593 13:75442489-75442511 ACATTTAAGTTTGAGTGTCAGGG + Intronic
1112335163 13:98508807-98508829 TGTTTTAAGTGGGAGCTTCATGG - Intronic
1121547802 14:94775021-94775043 ACTTTCAAGTGGCAGCCTCAGGG + Intergenic
1126424519 15:48512539-48512561 ACTTTTAAGTGGGAGCTAAATGG - Intronic
1127771932 15:62239276-62239298 TCTTTTAAGTAGGAATGGCAGGG - Intergenic
1131087139 15:89586630-89586652 AATTTTAAGTAGGGTGGTCAGGG + Intronic
1134796598 16:17043130-17043152 ACTTATAAGTGGGAGCTTAATGG + Intergenic
1138301539 16:55934100-55934122 AATTTTAAATAGGACAGTCAAGG - Intronic
1139415396 16:66804118-66804140 TATTTTAAATAGGAGAGTCAGGG + Intronic
1141725395 16:85784823-85784845 AGTGTTAAGTAGGAGGGTAAGGG - Intronic
1142822154 17:2478361-2478383 ACTTTTAAGTAGGATTTTCAAGG - Intronic
1145971521 17:28959221-28959243 CCTGTGAAGGAGGAGCGTCAGGG + Exonic
1151586785 17:75013641-75013663 AATTTTAAGTAGGATTGTCTAGG + Intronic
1155576927 18:27258679-27258701 ACTTGTAAGTGGGAGCTACATGG - Intergenic
1155791829 18:29981662-29981684 CCTTTTAAGAAGGAGAGTTATGG + Intergenic
1157976096 18:52328664-52328686 AATCTTAAGTAAGAGAGTCAAGG - Intergenic
1162217900 19:9151477-9151499 ATGTTAAAGTAGCAGCGTCACGG + Intronic
1166540860 19:43604773-43604795 AGTTTTAAGTAGGGTGGTCAAGG - Intronic
1167626158 19:50590888-50590910 AATTTTAAGAAGGAGGTTCATGG - Intergenic
926771554 2:16381563-16381585 ACTTTTAAACAGGATGGTCAGGG + Intergenic
927409787 2:22811501-22811523 AGTATTAAATAGGAGCATCAGGG + Intergenic
928035765 2:27821525-27821547 ACTTTTAAGTGGATGGGTCATGG + Intronic
931391424 2:61847316-61847338 AATTTTAAATAGGAGAGTCAGGG - Intronic
940579792 2:155564004-155564026 ACTTTTAAATAGCATGGTCAGGG + Intergenic
942292729 2:174487629-174487651 TCTCTTATGTAGGAACGTCAAGG - Intergenic
945602525 2:211886227-211886249 AATTTTAAATAGGATGGTCAGGG - Intronic
946969051 2:225071418-225071440 ACTGTTAAGTATGACCGTTAAGG - Intergenic
947053233 2:226070974-226070996 ACTTTTAGGTAGAAGGCTCAAGG - Intergenic
1171211644 20:23321436-23321458 TGTTTTAGGTAGGAGGGTCAGGG + Intergenic
1172119771 20:32591242-32591264 ACTTTTAAGAAGGGCAGTCAAGG - Intronic
1173766933 20:45620122-45620144 ATTTTTAAGTATGAGAGCCATGG + Intronic
1174707449 20:52670759-52670781 ACTTTTAAATAGGGTGGTCAGGG + Intergenic
1179137627 21:38694411-38694433 ACTTTTAAGTTGGATCTTGAAGG - Intergenic
1179230168 21:39495767-39495789 ACTTTTCAGAAGGAGCATGATGG - Intronic
1181729671 22:24835587-24835609 AATTTTAAATAGGATCGTCAGGG + Intronic
950241450 3:11373610-11373632 ACTTCTAAGTAGGAAGGTCACGG + Intronic
950665570 3:14492969-14492991 ACTCTTAAGTTGGGGCGTCTGGG - Exonic
951550431 3:23871314-23871336 ACTTCTCAGTAGGGGCGGCAGGG + Intronic
951550479 3:23871443-23871465 ACTTCTCAGTAGGGGCGGCAGGG + Intronic
955844642 3:63149260-63149282 GCTTTTAAGCAGGAGAGTGACGG + Intergenic
955942658 3:64161080-64161102 ACTTTTAAGTAGGAGCGTCAGGG - Intronic
956190835 3:66606847-66606869 AATTTTAAATAGGAGGGTCGGGG - Intergenic
958937044 3:100266798-100266820 ACTTTTAAGTAGGAGTCTTCTGG + Intronic
959462000 3:106638461-106638483 ACTTTTAAGTTCTAGCTTCATGG + Intergenic
961396854 3:126599463-126599485 AATTTTAAGTATGAGCAGCATGG - Intronic
963631991 3:147744996-147745018 AATTTTAAGTAGGATGGCCAGGG + Intergenic
967080253 3:186043240-186043262 AATTTTAAGTAGGGAGGTCAGGG - Intergenic
972855703 4:43104074-43104096 ACATTTGGGTAGGAGAGTCATGG - Intergenic
976538370 4:86243697-86243719 AGTTTTAAATAGGATGGTCAAGG - Intronic
976805449 4:89041059-89041081 ACTTTTAAGTAGGTGGCTGAAGG - Intronic
977279722 4:95024770-95024792 ACTTTTACTTAGGATTGTCATGG + Intronic
980652848 4:135743114-135743136 AGTTTTAAATAGGATGGTCAGGG - Intergenic
980842738 4:138285534-138285556 ACTTTCAAGTATTAGTGTCATGG + Intergenic
982229180 4:153192864-153192886 AGTTTTAAATAGGATGGTCAAGG - Intronic
986351636 5:6885587-6885609 ACATTTGAGTGGGAGCCTCAAGG + Intergenic
987446901 5:18031271-18031293 ACTTTTAAGTGGGAGCTAAATGG - Intergenic
991399613 5:66239370-66239392 AGTTTTAAGTAGGGTGGTCAGGG + Intergenic
992844116 5:80727834-80727856 ACTTTTAAATAGGATGGTAAAGG + Intronic
998710640 5:144821294-144821316 GCTTTTAAGTAGAAGAGCCAGGG + Intergenic
1000391156 5:160724803-160724825 AGTTTTAAATAGGATGGTCAAGG - Intronic
1003276498 6:4658490-4658512 CATTTTAAGTAGGATGGTCAGGG + Intergenic
1004078255 6:12365373-12365395 ACTGTTAAGTAGGAACGGAATGG + Intergenic
1004097675 6:12574697-12574719 ACTTGTAAGCAGGAGGGTAAGGG + Intergenic
1005465793 6:26111309-26111331 ACTTCTAAGTAGCAAAGTCATGG + Intergenic
1005834448 6:29697235-29697257 ACTTTGTAGTTGGAGCTTCAGGG + Intergenic
1009012976 6:57865012-57865034 AGTTTTCAGTAGAAGAGTCAGGG - Intergenic
1010402796 6:75466122-75466144 AATTTTAAATAGGATGGTCAGGG - Intronic
1014033317 6:116735299-116735321 TCTTTTAAGAAGGAGCATTATGG + Exonic
1015344195 6:132136336-132136358 AATTTTAAATAGGACAGTCAAGG - Intergenic
1015717562 6:136208098-136208120 ACTGTTAAGTGGAAGCCTCACGG - Intergenic
1015735922 6:136400080-136400102 ACTTTTTTGTAGGAGGGGCAGGG - Intronic
1016158237 6:140841818-140841840 ACTTTTAAGGAGTATCATCAAGG - Intergenic
1017333646 6:153229048-153229070 ACATATAAGTAGGAGTGTCAAGG + Intergenic
1018755792 6:166848959-166848981 ACTTCTAAGCAGGAGAGTGATGG - Intronic
1021247802 7:18285403-18285425 ACTTTAAAGTAGCAGTGTGATGG + Intronic
1021495209 7:21266886-21266908 ACTTTTAGGTAAGAACTTCAAGG - Intergenic
1022150900 7:27604826-27604848 GCTTTTAAGTGGGAACATCAAGG + Intronic
1022331724 7:29385559-29385581 ACTTTTAAGTAGGGGGATCTGGG + Intronic
1025724793 7:64046514-64046536 ACTTTTAAATAAGAACTTCAGGG - Intronic
1027503468 7:78984643-78984665 AATTTTAAATAGGACTGTCAGGG - Intronic
1028171987 7:87609186-87609208 AATTTTAAGTAGGATAGTCAGGG + Intronic
1030348510 7:108457885-108457907 ACTTTCAAGTAGGGGGATCATGG - Intergenic
1030793769 7:113761744-113761766 ACTTTTATATAAGAGCTTCAAGG - Intergenic
1031071431 7:117166558-117166580 CCTTTTAAGCAGGAGTGTGATGG + Intronic
1031467328 7:122128447-122128469 TATTTTAAGTAGGATGGTCAGGG - Intronic
1031774645 7:125892346-125892368 ACTTATAAGCAGAAGCGTCAAGG - Intergenic
1031808929 7:126341466-126341488 AATTTTAAATAGGATGGTCAAGG - Intergenic
1038227811 8:25673003-25673025 TCTTTAAATTAGCAGCGTCAGGG - Intergenic
1039258692 8:35747008-35747030 ACCTTTAAGTAGGGGAGGCAAGG - Intronic
1042207631 8:66345081-66345103 ACTTTTGAGTAGGAGGTTCTGGG - Intergenic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1044410488 8:91876861-91876883 AATTTTAAGTAGGATGGTCAGGG - Intergenic
1047154353 8:122300201-122300223 ACATTTAAGTAGAAGGCTCAAGG - Intergenic
1050591258 9:7162756-7162778 ACTTTCAAGCAGGAGAGTTACGG - Intergenic
1050758857 9:9041429-9041451 ACTTATAAGTAGGAGCTAAATGG - Intronic
1058405784 9:104672704-104672726 AATGATAAGTAGGAGCTTCAAGG - Intergenic
1059714701 9:116903153-116903175 AATTTTAAGTAGAAGAATCAGGG - Intronic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1187713463 X:22077364-22077386 AATTTTAAGTTGGAGCATTATGG + Intronic
1189119416 X:38378280-38378302 AATTTTAAGTAGTATGGTCAAGG - Intronic
1192577442 X:72254344-72254366 ACTTTAAAGAAGGTGGGTCAGGG - Intronic
1193761917 X:85477322-85477344 ATTTTTAAGTAGGATAGTTAAGG - Intergenic
1194676903 X:96805323-96805345 AATTTTAAGTAGGATGATCAGGG + Intronic
1194887529 X:99335262-99335284 ACTTTTAAGTGGGAGCTAAATGG - Intergenic
1196683231 X:118489873-118489895 ACTTTTAAATACGAAGGTCAAGG + Intergenic
1196938233 X:120750725-120750747 TATTTTAAGTAGGATGGTCAGGG - Intergenic
1197255511 X:124258606-124258628 AGATTTAAGTAGGAGCAGCATGG - Intronic
1197986361 X:132270093-132270115 ACTTTTAAGGAGGATCATGAAGG - Intergenic
1198314946 X:135455803-135455825 ACTTTTGAGTGGGAGAGCCAAGG + Intergenic