ID: 955945248

View in Genome Browser
Species Human (GRCh38)
Location 3:64187621-64187643
Sequence GTTTTTATGGGGGTTTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955945248 Original CRISPR GTTTTTATGGGGGTTTTAGA AGG Intronic
900774534 1:4572242-4572264 GATTTGATGTGGGTTTGAGAAGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
904917369 1:33979930-33979952 TTATTTTTGGGGGTTTTAGTGGG + Intronic
907564286 1:55420311-55420333 GATTTAATGGGATTTTTAGAAGG + Intergenic
909279224 1:73727423-73727445 GTTTTTATGGGGAATAAAGAGGG + Intergenic
910583126 1:88850161-88850183 ATCTTTATGGAGGTTTTAGTTGG - Intergenic
910803382 1:91166798-91166820 ATTTTTCTGGGGGCTTTGGAAGG - Intergenic
912092510 1:106097896-106097918 ATTTTTATGGGGGTTATATTTGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914406805 1:147383036-147383058 ATGTTTCTGTGGGTTTTAGAAGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
917435949 1:175021522-175021544 ATTGTTATTGGGGTGTTAGAAGG - Intronic
919066891 1:192703112-192703134 TTTTTGATGGGGCTTTTTGATGG - Intergenic
921234358 1:213109839-213109861 TTTTTTATTGGAGATTTAGAGGG + Intronic
921612222 1:217226130-217226152 GTTTTTATGTGGGCTTAAGGTGG - Intergenic
922673563 1:227533338-227533360 GTTTTTAATGAGGTTTTTGAGGG - Intergenic
923150758 1:231231337-231231359 GTTTTTATAGGGGTTAGATATGG - Intronic
923235452 1:232028619-232028641 GTTTTTATGGGGGTTAAATAAGG + Intronic
923417805 1:233781520-233781542 GTTTTTAAGGGTGTTTTTAAGGG + Intergenic
923553012 1:234979236-234979258 ATTTTTATGGGGTTTTTATTTGG + Intergenic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1063228837 10:4043627-4043649 GTCTTTAGGGGGGTCTTATAAGG + Intergenic
1065459228 10:25938424-25938446 GATTTTGTGGGGTTTTTAGCAGG + Intronic
1065522578 10:26586754-26586776 GTTTCTATGAGGCTTTTATAAGG + Intergenic
1066074411 10:31858746-31858768 GATTTTAGTGGGGTTTGAGAGGG - Intronic
1066238418 10:33509518-33509540 GTTTTCATGTGGGTTTTCAAGGG - Intergenic
1066407745 10:35135159-35135181 GTTTTTATCAGTGTGTTAGATGG + Intronic
1072408577 10:95178346-95178368 GTTTACATGGGTATTTTAGATGG - Intergenic
1072677578 10:97479798-97479820 GGTTTATTGGGGGTTTTAGTTGG - Intronic
1072814992 10:98498589-98498611 GATTTTTTGGGGGTGTTAAAGGG - Intronic
1073057300 10:100710732-100710754 GCTTTTATGGGGGTGGGAGAGGG - Intergenic
1074713951 10:116201439-116201461 GTTTTTATGGGATGTTGAGAGGG - Intronic
1075286791 10:121194265-121194287 GTTTTGATGGGGGCTTTTAAGGG + Intergenic
1075400776 10:122159925-122159947 GTTTTTCTTGGGGTGTCAGAGGG + Intronic
1075880212 10:125844669-125844691 GTTTATATGGGGGTTCTTTAGGG + Intronic
1076370952 10:129953397-129953419 GTTTTGGTGGGGGTTGAAGAGGG - Intronic
1078385154 11:10884241-10884263 GTTTTTATTAGGATTTTAGAAGG + Intergenic
1078864085 11:15280585-15280607 GGTTTCATAGGGGTTTCAGAAGG + Intergenic
1079205078 11:18407814-18407836 GGTTTATTGGGGGTTTTAGTTGG - Exonic
1079425461 11:20337850-20337872 ATTTAAATGGAGGTTTTAGAAGG + Intergenic
1080219297 11:29881626-29881648 GTTTTTAAGGGTGGTTTAGTGGG - Intergenic
1082946185 11:58763350-58763372 ATTTTTATGGGAGATTTGGAGGG + Intergenic
1084450622 11:69234661-69234683 GTTTTTTTGGGGGTTTTTTTTGG - Intergenic
1086047517 11:82550105-82550127 GTTATTAAAGGGTTTTTAGATGG - Intergenic
1086330498 11:85749171-85749193 GTTTTTAGGGAAGTTTTAGGAGG - Intronic
1090415676 11:126538670-126538692 ATTTTTATGGAGGTTCTAGGGGG + Intronic
1093942343 12:25068451-25068473 GTTTTTATGGAGGCTTTACTAGG + Intronic
1094751715 12:33417141-33417163 GTTTCAATGTGAGTTTTAGAGGG - Intronic
1095557279 12:43522714-43522736 GTGTTTGTGGGGGTTTTTGTTGG + Intronic
1097796623 12:63869514-63869536 GTATTTGGGGGTGTTTTAGAAGG - Intronic
1099302184 12:80911232-80911254 GATTTTAAGGAGGTTCTAGAGGG + Intronic
1099577372 12:84398461-84398483 CTTTTTATTGGGGTTAGAGATGG - Intergenic
1101014582 12:100486577-100486599 GTTTCTTTGGGAGTTTGAGACGG - Intronic
1103402593 12:120653538-120653560 GTTTTTTTGTGGTTTTGAGATGG + Intronic
1105725877 13:23161111-23161133 GGTTACTTGGGGGTTTTAGAGGG + Intergenic
1107296974 13:38919669-38919691 GTTTTCATGGGGGCTTTTTAAGG + Intergenic
1107436365 13:40383747-40383769 TTTTTTGTGGGAGTTCTAGAAGG - Intergenic
1107719515 13:43233175-43233197 GTTTTTATGGGGGCATTGCAGGG - Intronic
1108087681 13:46811286-46811308 GTTTTTAAGTGGGTTCTATAGGG + Intergenic
1108227446 13:48303916-48303938 GTTTTTCGGGGGGTTTTGGGCGG - Exonic
1108702807 13:52958032-52958054 GTTATTGTGGGGTTGTTAGAAGG + Intergenic
1108806352 13:54161575-54161597 GTTTTCATGTTGGTTTTACAGGG + Intergenic
1110870829 13:80450803-80450825 GTTTTAATGTGAGTTTTGGAGGG + Intergenic
1111411009 13:87876762-87876784 GTTTTCATGGTAGTTTTTGAGGG - Intergenic
1111664254 13:91247019-91247041 GATGTTTTGGGGGTTTTTGAAGG + Intergenic
1111879949 13:93943796-93943818 CTTTTTAAGGGTGATTTAGAGGG + Intronic
1112904181 13:104396962-104396984 GCTTTTATTGGGGTTTTTGTGGG - Intergenic
1114760797 14:25311784-25311806 GTCTTTATTGTAGTTTTAGAGGG + Intergenic
1115537213 14:34384588-34384610 GTTTGGATGGGGGTTGTAGGGGG + Intronic
1115795321 14:36929119-36929141 ATTTTTATGGAGGTCTTACATGG - Intronic
1117363389 14:54999977-54999999 GTTTTTGTGGGGGTTTCAGGAGG + Intronic
1117897609 14:60504447-60504469 GTTTCTATGTGTATTTTAGAAGG + Intronic
1120994466 14:90406317-90406339 CTTTTAAAGGGGGTTTTACAGGG - Exonic
1122667925 14:103346657-103346679 GTTTGGATTGGTGTTTTAGATGG - Intergenic
1124110109 15:26777311-26777333 TTTTTTATGGCGATTTGAGAGGG + Intronic
1126514281 15:49518286-49518308 GTTTTTATAGGATTTTAAGATGG + Intronic
1127361552 15:58248734-58248756 GCTTTTATTGGGGTTTCTGAGGG + Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1129246563 15:74282528-74282550 GCTTTTAGAGGGATTTTAGAGGG + Intronic
1129309998 15:74700615-74700637 GTGTTTATGTGTGTTTGAGATGG + Intergenic
1129883467 15:79022461-79022483 TTTTTTGTGGGGGTTTTTGGGGG - Intronic
1130016430 15:80190096-80190118 CTTTTTCTGGGGGTGTTAAAGGG - Intergenic
1130048076 15:80461478-80461500 GATTTTGTGGGAGTTTGAGAGGG + Intronic
1130409182 15:83630630-83630652 CTTTTTAAAGGGGTTTTATAAGG - Intergenic
1130555172 15:84917585-84917607 GCTGTTATGTGGGTTTAAGAAGG - Intronic
1135551669 16:23403246-23403268 GTTTTTGAGGGGGCTTTGGAGGG - Intronic
1136155508 16:28379512-28379534 GTTATAATGGGTGTTTTAAAAGG - Intergenic
1136207576 16:28735777-28735799 GTTATAATGGGTGTTTTAAAAGG + Intergenic
1138875464 16:60943181-60943203 CTTTTTAAAGGGGTTTCAGATGG + Intergenic
1141488037 16:84354058-84354080 GTCTTTGTGGGGGTTGGAGAAGG + Intergenic
1144111929 17:12043821-12043843 GTTTTTATGGAGGTTTTATTAGG + Intronic
1147698802 17:42378252-42378274 GTTTTTTTGGTTGTTTGAGACGG + Intronic
1149155898 17:53629890-53629912 GTTTTAATATGCGTTTTAGAGGG + Intergenic
1149190413 17:54054766-54054788 GTTTTCTTGGGAGATTTAGAAGG + Intergenic
1149726846 17:58903689-58903711 GTTTTTATTGAGTTCTTAGAAGG + Intronic
1149827034 17:59838067-59838089 GTTTTTAAGGGGTTGTTAGATGG + Intronic
1150144574 17:62757018-62757040 GTTGTTTTGGAGGTTCTAGATGG + Intronic
1157455642 18:47826494-47826516 GTTTTTGTGGAGGTTGTAGAAGG - Exonic
1158576338 18:58641768-58641790 GATATTATGGGGTTGTTAGAAGG + Intergenic
1158644087 18:59228846-59228868 GTTTCAATGGAGGTTTTAGTTGG + Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159974201 18:74690440-74690462 GTTTTTTTGGGGGTTTTTTTTGG + Intronic
1163394339 19:17050442-17050464 TTTTTAATGGGAGTTTTGGAGGG - Intronic
1165847616 19:38828618-38828640 GTTTTTATTTTGTTTTTAGAGGG + Intronic
1166044457 19:40221807-40221829 GTTTTTGTTGTTGTTTTAGACGG - Intergenic
924986006 2:270669-270691 GGTTTTATTGGGGTTTTCGGAGG - Intronic
925554633 2:5116409-5116431 TTTGTAATGGAGGTTTTAGAAGG + Intergenic
926662271 2:15480773-15480795 GTTTGTTTGGGGTTTTTAGGGGG + Intronic
927840569 2:26439641-26439663 ATTTCTATGGTGTTTTTAGAGGG + Intronic
928600083 2:32896008-32896030 CTCTTTATGGGGGTTGAAGATGG + Intergenic
929264333 2:39901467-39901489 GTTTTTATTGGGGTTTAAGGAGG + Intergenic
929423735 2:41821616-41821638 GGTTTATTGGGGGTTTTAGTTGG - Intergenic
929976771 2:46642743-46642765 TTTTTATTAGGGGTTTTAGAAGG + Intergenic
930723153 2:54657250-54657272 TTTATTTTGGGGGGTTTAGAGGG - Intronic
931017490 2:58001425-58001447 GCTTTTCTGAGAGTTTTAGAAGG + Intronic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
933642209 2:84775997-84776019 GGTTTATTGGGGGTTTTAGTTGG + Intronic
934925012 2:98376214-98376236 GTGTTTCTGGTGGTTTTTGATGG - Intronic
935303678 2:101716536-101716558 GTTTTCATGGGGTTTAAAGAAGG + Intronic
935515172 2:104027280-104027302 GTTTTTATGGAGTTATTAAAAGG + Intergenic
936641932 2:114322853-114322875 TTTTTTATTGTGGTTTTAAAAGG - Intergenic
937643838 2:124243967-124243989 GTTTTTATGTTGACTTTAGAGGG + Intronic
939896631 2:147799661-147799683 TCTTTTATGGAGGTTTTTGAGGG + Intergenic
940085806 2:149857173-149857195 GTTTTTAAGGGAGATTTAAAAGG + Intergenic
940183546 2:150959522-150959544 GATTTTGTGGGGTTGTTAGAAGG - Intergenic
941391616 2:164921943-164921965 GTGTTTATGGGGGTTGTGGTTGG + Intronic
942172547 2:173302110-173302132 GGTTTTAGAGGGGTTTGAGATGG + Intergenic
942572685 2:177329693-177329715 GTTTTTATGGAGGCTTTATTAGG + Intronic
943098349 2:183456148-183456170 GTTTTTAGGGTTGTTTTGGAGGG + Intergenic
944693872 2:202183444-202183466 GTTTTTTGGGGGGTTTTTGGGGG + Intronic
945024232 2:205605392-205605414 GTTTTTATGGGGTTTTTTGTTGG + Intronic
948028241 2:234795504-234795526 GTTTTTATGTTTGTTTTAGTGGG + Intergenic
948271939 2:236681034-236681056 GTCTTTATTGGGTGTTTAGATGG + Intergenic
948637175 2:239346338-239346360 GTGTGTATGTGTGTTTTAGACGG - Intronic
1169480294 20:5974046-5974068 GGTTTTATGATGGCTTTAGAAGG + Intronic
1169491816 20:6077464-6077486 GGTTTTCTGTGTGTTTTAGAGGG - Intronic
1175155917 20:56971486-56971508 ACTTTTCTGGGGATTTTAGATGG + Intergenic
1177524075 21:22269854-22269876 GTTTTTAGTTGGGTCTTAGATGG - Intergenic
1177671186 21:24230435-24230457 ATTTTTGTGTGTGTTTTAGATGG - Intergenic
1178447289 21:32657850-32657872 GTTTTTAGAGGATTTTTAGAAGG - Exonic
1181371531 22:22422331-22422353 GTTTTTTTGGGGGTGTGAGTTGG + Intergenic
1182153428 22:28047531-28047553 CTTTTTGTGGGCGCTTTAGAGGG - Intronic
1182635897 22:31726810-31726832 GTTTTGCTGGGTGTTTTATATGG - Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183698743 22:39437999-39438021 TGTTTTAAGGGGGTTTGAGAAGG - Intergenic
949227277 3:1710194-1710216 CTTGTTATTGGGGTTTTGGAAGG - Intergenic
952467262 3:33602649-33602671 GTTTCTAAGGGGGTTTGGGAAGG - Intronic
954008056 3:47608921-47608943 GTTTGTGTGGGGGGGTTAGAAGG + Intronic
955140550 3:56264705-56264727 TTTTTTATGGGGTCTTTATAGGG - Intronic
955945248 3:64187621-64187643 GTTTTTATGGGGGTTTTAGAAGG + Intronic
956398674 3:68852611-68852633 GTTTTAATTGGGGTTTTGGGAGG - Intronic
956727356 3:72167503-72167525 GTTTTTTGGGGGGTGCTAGAAGG - Intergenic
956941524 3:74167425-74167447 ATTTTTATGGTGGTCTTAGGAGG + Intergenic
957794057 3:84980135-84980157 GTGTTTATAGGCGTTCTAGAAGG + Intronic
958140423 3:89555708-89555730 ATTTTTATTGTGGGTTTAGATGG + Intergenic
958938524 3:100284651-100284673 GTTGTGATGGGGGTTGTAGTGGG + Intronic
959746458 3:109780953-109780975 CCTTTTATTGGGGTTTTAAAAGG - Intergenic
960062033 3:113333133-113333155 GTATATCTGGGGGTTATAGATGG - Intronic
960998723 3:123357957-123357979 GTCTTTATGGGGGTGTAAGAAGG - Intronic
963612952 3:147495108-147495130 GTTTTTATTCTGGTTATAGAAGG + Intronic
963719508 3:148844883-148844905 TTTTTTTTGGTGCTTTTAGAAGG - Intronic
964454057 3:156841344-156841366 GTTTTTATGAGAGTTATAGAGGG + Intronic
965068028 3:163877979-163878001 GTTTTTATGAGGGTTTTGTTGGG + Intergenic
965988151 3:174781589-174781611 CTTTTTAGGGTGATTTTAGAAGG + Intronic
966060775 3:175751852-175751874 GTTTTTATGGGGTTTTTGTAGGG + Intronic
968094480 3:195918607-195918629 GTATTTATGTGTGTATTAGAGGG - Intergenic
969119059 4:4893635-4893657 GGTTTATTGGGGGTTTTAGTTGG + Intergenic
969207070 4:5655163-5655185 GTTCTTATGGGGTTTGTAAAGGG - Intronic
969343069 4:6554376-6554398 GTTTCTATGGAGGAATTAGAGGG - Intronic
969644558 4:8419971-8419993 GTTGTTATGAGGGTTTTATCAGG - Intronic
969854105 4:9985328-9985350 GTTTTCATGGGGCTTTTATGAGG - Intronic
973284213 4:48397234-48397256 TTTTTAATGGGGTGTTTAGAAGG - Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
975896780 4:79102411-79102433 GTTTTTGTGATGGTTTTAGTAGG + Intergenic
976374583 4:84329780-84329802 GTATTTCTGGGGGGTTTTGATGG + Intergenic
976462636 4:85330352-85330374 GATTTTATTGGGGTTTTTGGAGG + Intergenic
977434007 4:96970235-96970257 GTATTTATGTGGTTTTTAAATGG + Intergenic
978442759 4:108751055-108751077 CTTTTTAGGGGGGTTGTAGGGGG - Intronic
978490713 4:109308739-109308761 GTTTTTGGGGGGGTTTTGGGGGG + Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
978718461 4:111875241-111875263 GTTTGTTTGGGGGTTTTGAATGG + Intergenic
979400900 4:120248197-120248219 GTTTATTTGAGGATTTTAGAAGG - Intergenic
979749382 4:124258675-124258697 GTTTTTATTGTGGTTGTGGATGG + Intergenic
980119804 4:128716056-128716078 GTTTTTACTCTGGTTTTAGAAGG - Intergenic
982742332 4:159070850-159070872 GGTTTTATGAATGTTTTAGAGGG + Intergenic
982750263 4:159152620-159152642 GTTTTTTTGGTTTTTTTAGATGG + Intronic
985120193 4:186632156-186632178 GGTTTTATAGGGATTTTAGTTGG + Intronic
987035207 5:14012209-14012231 GTTTCTATGGAGGTCTTAGCTGG - Intergenic
989470172 5:41807030-41807052 GTTTTTCTGGCTGTCTTAGAGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
992383234 5:76259077-76259099 TTTTTTGTGGGGTTTTTACAGGG + Intronic
994216830 5:97146982-97147004 GTCTTTATGGGCATTTAAGAAGG - Intronic
994951082 5:106463979-106464001 ATTGTTTTGGTGGTTTTAGAGGG - Intergenic
995434771 5:112123294-112123316 GTTTTTAGCAGGGTTTTAGCAGG - Intergenic
995806200 5:116054925-116054947 GTTTTTATGGAGTTTTTAATGGG - Intronic
996560707 5:124825910-124825932 ATTTCCATGTGGGTTTTAGAGGG + Intergenic
996929730 5:128871324-128871346 GTTTTTATGGGTCCTATAGAAGG - Intronic
997051033 5:130380292-130380314 GTTTCTATGGGAGATTTAGGGGG + Intergenic
998921960 5:147079108-147079130 GTCTTCATAGGGGCTTTAGAAGG + Intronic
1000100874 5:158015052-158015074 TGTTTTATGGGGGTTTTAGTGGG - Intergenic
1000438180 5:161239160-161239182 GTATGTATGTGGGTTCTAGATGG - Intergenic
1000758886 5:165196162-165196184 GATTTTATGGATGTTTTAAAGGG + Intergenic
1002428609 5:179190343-179190365 GATATTATGGGGTTGTTAGAAGG + Intronic
1002806899 6:585998-586020 GTTTTTATGCGGGTTTTCTCAGG - Intronic
1003387146 6:5679368-5679390 GTTTTTATTTGGATTTTAGAGGG - Intronic
1004489084 6:16097023-16097045 GTTTTTCATTGGGTTTTAGAGGG + Intergenic
1005846589 6:29784986-29785008 CTTTTTATGGGGTTGTTTGATGG - Intergenic
1007125971 6:39425921-39425943 GTTTTCCTGTTGGTTTTAGATGG + Intronic
1008397579 6:51026532-51026554 GTTTTTATGTGGGATCTTGATGG + Intergenic
1008788287 6:55197322-55197344 GTTCTGATGAGGGTTTCAGATGG - Intronic
1012865844 6:104616977-104616999 GTTTCAAGGTGGGTTTTAGAGGG - Intergenic
1014557626 6:122853228-122853250 GTTTTTATAGGGGTGTTTGTGGG + Intergenic
1014575988 6:123073573-123073595 GTTTATATTGGGGTTTTCCATGG - Intergenic
1014631111 6:123790798-123790820 GTGTTTATTAGGGTTGTAGAAGG + Intergenic
1015562762 6:134534297-134534319 GTTTTTGTAGTGGTTTTAGCAGG - Intergenic
1015655970 6:135519450-135519472 GTTTTAATGTGAGTTTTGGAGGG + Intergenic
1016211592 6:141541790-141541812 GTTTTTATAGGGGTTATAATGGG + Intergenic
1019410216 7:903599-903621 GCTTTTGTGGGGGTTTTACCTGG + Intronic
1020737456 7:11968989-11969011 GTTTTGATGTGGATTTCAGAAGG + Intergenic
1020802656 7:12750488-12750510 GTTTTAATGTGGATTTTGGAAGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027851357 7:83456413-83456435 GTTTTTATGGGGGGATTTCATGG - Intronic
1028458537 7:91064765-91064787 GTTTGGATGGGGGATTTGGAAGG + Intronic
1031716632 7:125116537-125116559 GTTGTTATGGGGTTTTAATATGG + Intergenic
1032565335 7:132936067-132936089 ATTTTGATGTGAGTTTTAGAAGG + Intronic
1033245082 7:139711076-139711098 GATTTCATGGTGGTTTTAGGTGG - Intronic
1033415256 7:141156058-141156080 GTTTTTTTGGTTGTTTGAGATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035852789 8:2938135-2938157 GTGTTCATGGGGGTTTAAAAAGG + Exonic
1037040466 8:14225199-14225221 ATTTTTATTGTGGTTTAAGAAGG + Intronic
1037954047 8:23039565-23039587 GTTTTGTTGTTGGTTTTAGATGG - Intronic
1039200761 8:35091136-35091158 GTTTTTTTAGGTGTCTTAGAGGG - Intergenic
1040877241 8:52166499-52166521 GTCTTTATGGTGGTTTCTGATGG - Intronic
1040944019 8:52863124-52863146 GTTTTTGTGGGGGCTTGTGATGG + Intergenic
1041125639 8:54635841-54635863 TTTCTTGTGGGGGTTGTAGATGG - Intergenic
1041651293 8:60305995-60306017 GATATTATGGGGTTGTTAGAAGG + Intergenic
1042346190 8:67730460-67730482 GTTTTTATGGAGGGTTATGAGGG + Intronic
1043957825 8:86382693-86382715 GGTTTTTTGCGGGTTTGAGATGG - Intronic
1045930464 8:107620133-107620155 GTTCTTATGGGAGATTTTGAAGG + Intergenic
1046207692 8:111023002-111023024 GTTTTTCAGGTGGTTTGAGAGGG + Intergenic
1048529743 8:135236448-135236470 GTTTTCAAGGGGGTTATTGATGG + Intergenic
1050951134 9:11595963-11595985 TTTGTTATGAGGGTTTTAGCTGG + Intergenic
1051227788 9:14920776-14920798 GGTTTATTGGGGGTTTTAGTTGG + Intergenic
1051281574 9:15446688-15446710 GTTTTTATTGGGGTTTCTGTGGG + Intronic
1054922119 9:70553380-70553402 ATTTGTAGGAGGGTTTTAGATGG + Intronic
1055037654 9:71835604-71835626 GTTTTTATGGGTGATTTGGTGGG - Intergenic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056944011 9:90978386-90978408 GGTATTATGAGTGTTTTAGAGGG - Intergenic
1058154418 9:101498803-101498825 GTTTAAATTGGTGTTTTAGATGG + Intronic
1062050787 9:134445843-134445865 ATTTTTGTGGGGGTTTTTGGTGG - Intergenic
1185702264 X:2239843-2239865 GGATTCATGGGGGTTTTATAAGG + Intronic
1188434979 X:30149174-30149196 TTTTTATTGGGGATTTTAGAAGG + Intergenic
1189339471 X:40193630-40193652 GTTTATTTGGAGGTTTAAGATGG + Intergenic
1190536947 X:51438693-51438715 GTTTTTTTGGGTGTTTTTGTGGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195678809 X:107528164-107528186 CTTTTTATAGGGCTTTTATAGGG - Intronic
1196545191 X:116955543-116955565 GTTTTTATTGTGGTTTTAGTTGG - Intergenic
1197791795 X:130262472-130262494 GTTTTTGTGATAGTTTTAGAAGG - Intronic
1199715020 X:150501621-150501643 GTTTTTGTTTGGGTTTTAGAGGG + Intronic
1199922541 X:152424292-152424314 GTTTTTGAGGGGGTGTTAGGGGG - Intronic
1200925657 Y:8652184-8652206 GTTTTTATACAGGTTTTACATGG + Intergenic
1201540360 Y:15099413-15099435 GATATTATGGAGGTGTTAGAAGG + Intergenic