ID: 955948305

View in Genome Browser
Species Human (GRCh38)
Location 3:64216826-64216848
Sequence TGCCTGCCTCATTAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955948305_955948310 3 Left 955948305 3:64216826-64216848 CCTCCTTCCTAATGAGGCAGGCA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 955948310 3:64216852-64216874 CGGAGTGGCCCAACCTCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 69
955948305_955948318 17 Left 955948305 3:64216826-64216848 CCTCCTTCCTAATGAGGCAGGCA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 955948318 3:64216866-64216888 CTCCACAGGATGCAAGGGTGGGG 0: 1
1: 0
2: 0
3: 20
4: 296
955948305_955948315 15 Left 955948305 3:64216826-64216848 CCTCCTTCCTAATGAGGCAGGCA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 955948315 3:64216864-64216886 ACCTCCACAGGATGCAAGGGTGG 0: 1
1: 0
2: 3
3: 14
4: 322
955948305_955948317 16 Left 955948305 3:64216826-64216848 CCTCCTTCCTAATGAGGCAGGCA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 955948317 3:64216865-64216887 CCTCCACAGGATGCAAGGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 171
955948305_955948314 12 Left 955948305 3:64216826-64216848 CCTCCTTCCTAATGAGGCAGGCA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 955948314 3:64216861-64216883 CCAACCTCCACAGGATGCAAGGG 0: 1
1: 0
2: 2
3: 9
4: 176
955948305_955948312 11 Left 955948305 3:64216826-64216848 CCTCCTTCCTAATGAGGCAGGCA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 955948312 3:64216860-64216882 CCCAACCTCCACAGGATGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 188
955948305_955948319 18 Left 955948305 3:64216826-64216848 CCTCCTTCCTAATGAGGCAGGCA 0: 1
1: 0
2: 1
3: 14
4: 171
Right 955948319 3:64216867-64216889 TCCACAGGATGCAAGGGTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955948305 Original CRISPR TGCCTGCCTCATTAGGAAGG AGG (reversed) Intronic
901449132 1:9325461-9325483 TGCCCACCTCTTCAGGAAGGTGG + Intronic
901822806 1:11841038-11841060 TGCCTGCTTCATCAGGAAGACGG - Exonic
902275081 1:15333776-15333798 TACCTGCCTCACTGGGTAGGTGG - Intronic
902658938 1:17887941-17887963 CGCCTGGCTCAGTAGGAAAGAGG + Intergenic
903255145 1:22092574-22092596 GGCCTGCTTCATTAAGAAGCTGG + Exonic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
903705368 1:25281657-25281679 TGCTTGCATCCTTAGGAATGGGG - Intronic
903721860 1:25411673-25411695 TGCTTGCATCCTTAGGAATGGGG + Intronic
903975347 1:27146184-27146206 TCCCTGCCTCAGGAGGAAAGGGG + Intronic
905904437 1:41608467-41608489 TGCCTGCCTCTTTGTGAAGAAGG + Intronic
906069341 1:43006192-43006214 TGGCTGCCTCATTAGTACCGTGG - Intergenic
906264658 1:44418701-44418723 TCCCTGCCTAATGAGGAAAGGGG - Intronic
908779793 1:67679857-67679879 GGTATGGCTCATTAGGAAGGGGG + Intergenic
909518004 1:76533880-76533902 TGCCTGCCTCTGCAGGGAGGGGG - Intronic
913297309 1:117334627-117334649 TGCCAGCCTCATTAGCGAGCTGG + Intergenic
913660657 1:121003721-121003743 TGCCTGCCTCATCTGGAACTGGG + Intergenic
914012021 1:143786877-143786899 TGCCTGCCTCATCTGGAACTGGG + Intergenic
914165811 1:145174257-145174279 TGCCTGCCTCATCTGGAACTGGG - Intergenic
914650651 1:149695537-149695559 TGCCTGCCTCATCTGGAACTGGG + Intergenic
914848180 1:151294246-151294268 TTCCTGCCCAATAAGGAAGGGGG - Intronic
915131284 1:153697373-153697395 TGCCTGCCTGCCTGGGAAGGAGG - Intergenic
915355177 1:155251525-155251547 TGACTGCCTCATAAGAAGGGGGG + Exonic
915914838 1:159934654-159934676 GGTCACCCTCATTAGGAAGGTGG - Intronic
917219575 1:172714180-172714202 TTCCTGCCTAATTCAGAAGGTGG - Intergenic
918543607 1:185657994-185658016 TGTCTGCCTCAATAGGATAGAGG - Intergenic
918627859 1:186679285-186679307 TGGTTGCCTCATTAGGAGTGGGG - Intronic
921715628 1:218414589-218414611 TGCTTGCCTCATAAGGAAACTGG + Intronic
923532995 1:234826370-234826392 CACCTGCCTCATAAGGATGGTGG + Intergenic
1062823469 10:551506-551528 TTCCTGGCTCAAGAGGAAGGAGG + Intronic
1063049691 10:2433436-2433458 TGCATGCCTCTTTAGGGAAGCGG + Intergenic
1063063990 10:2590480-2590502 TGCCTGCCTCCTTAGGAATTGGG - Intergenic
1063064001 10:2590547-2590569 TGCCTGCCTCATTAGGAATTGGG - Intergenic
1063064014 10:2590614-2590636 TGCCCGCCTCCTTAGGAATTGGG - Intergenic
1063744162 10:8860823-8860845 TGTCTCCCTCATTAGGGAGATGG - Intergenic
1065325635 10:24548842-24548864 TGCCTGCCTCTTCAGGAAACTGG + Intergenic
1068855052 10:61789074-61789096 TGCCTGCCTAATTAGAGTGGTGG + Intergenic
1068982400 10:63075392-63075414 TGCCAGCCTGTGTAGGAAGGAGG + Intergenic
1073327844 10:102652566-102652588 GGCCTGCCTCTGAAGGAAGGTGG + Intronic
1075762503 10:124867144-124867166 TGCCTGCCTAATGAGGTGGGTGG + Intergenic
1079110663 11:17603348-17603370 GGCCTGCCACATCTGGAAGGTGG - Intronic
1080424099 11:32140276-32140298 TGCATGCCTGACTAGGAAGGGGG - Intergenic
1082199843 11:49352836-49352858 TTGCTGACTGATTAGGAAGGTGG + Intergenic
1084388252 11:68858028-68858050 TGCCTGACTGCTTTGGAAGGGGG - Intergenic
1085235957 11:75015696-75015718 TGCCAGCCTCATGAGGTAGGAGG + Intronic
1086655825 11:89353360-89353382 TTGCTGACTGATTAGGAAGGTGG - Intronic
1089146883 11:116335760-116335782 TGTCTGCCTCATTGGGCTGGGGG - Intergenic
1090177970 11:124668390-124668412 TGCATGCCTCATTAAGGAAGAGG + Intronic
1091975368 12:4820385-4820407 TGAATGCCTCTTTAGGAAGAAGG + Intronic
1092005935 12:5070425-5070447 GGCCAGCCTCATAGGGAAGGTGG + Intergenic
1095455621 12:42382412-42382434 TGGGTTCCACATTAGGAAGGAGG - Intronic
1098363811 12:69681471-69681493 GGCCTGCATCATAAGGAGGGAGG - Intronic
1098646692 12:72910921-72910943 TGACTGCCTCATTCTGAAGTGGG - Intergenic
1098771723 12:74560761-74560783 TCCCTGCCACATTATGAAGAAGG - Intergenic
1102688072 12:114739674-114739696 TGCCTGCCCTAGTAGGAAGGAGG + Intergenic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1103518866 12:121524617-121524639 TGCCTCCCTCAGTAAGAAGGAGG + Intronic
1103938053 12:124486833-124486855 TGGCAGTCTCATTTGGAAGGTGG - Intronic
1108596483 13:51954318-51954340 TCACTGCCACGTTAGGAAGGTGG + Intronic
1112370473 13:98788774-98788796 TTCCTGCCTCACTGGGGAGGGGG - Intergenic
1113885598 13:113656976-113656998 TCCCTGCCTCTCTAGGAACGGGG + Intronic
1116174507 14:41450281-41450303 TGCCCTCTTCATAAGGAAGGGGG - Intergenic
1117407122 14:55415122-55415144 TGCCTGCATAATTTGGAAGCTGG - Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118711246 14:68521313-68521335 TGCCTGGCTCATGAGAAGGGAGG - Intronic
1120581663 14:86257880-86257902 TGCCTTCCACATTAGAAATGAGG + Intergenic
1120843620 14:89107786-89107808 GGCCTCCCTCATGAGGCAGGGGG + Intergenic
1121038599 14:90726979-90727001 CTCCTGCCTCATAAGGAAAGAGG + Intronic
1122348775 14:101076131-101076153 TTCCTCCCTCATTAGGGAAGAGG - Intergenic
1125714156 15:41809832-41809854 TGCCTGCCTCACAGAGAAGGTGG - Intronic
1125767564 15:42145675-42145697 TGCCTGTCTCCTTAGGTATGTGG - Exonic
1125890902 15:43266591-43266613 TGCCTGCCTCCATAGCCAGGTGG - Intronic
1126407625 15:48337475-48337497 TGCCTGCCTCTAGAGGTAGGAGG + Intronic
1128792596 15:70444195-70444217 TGCCTGCCCCTTGAGGAAGTCGG - Intergenic
1133724469 16:8524587-8524609 AGCCTGCCTCATGAGCAGGGAGG + Intergenic
1134118284 16:11565789-11565811 TGCCAGACCCATCAGGAAGGAGG - Intronic
1135158196 16:20072260-20072282 TGCCTGCCAAATTTGGGAGGGGG + Intronic
1138657813 16:58500969-58500991 TGCCTGCCTTATTTTGTAGGTGG + Intronic
1138888041 16:61104600-61104622 TGCCTGCATCATATGGTAGGTGG + Intergenic
1139508275 16:67410482-67410504 TGCCTGCCTCAGAAGCCAGGTGG - Intronic
1140967244 16:79978589-79978611 TGCCTGGCTTGTTAGGAAGATGG + Intergenic
1141933973 16:87224259-87224281 TGCCTGCTTCATCGGGAGGGAGG - Intronic
1141980666 16:87548078-87548100 TGTCTGCTACAGTAGGAAGGGGG - Intergenic
1143602279 17:7955607-7955629 GCTCAGCCTCATTAGGAAGGAGG + Intergenic
1144884142 17:18447631-18447653 AGCCTGCCCCAAAAGGAAGGGGG - Intergenic
1147579838 17:41622081-41622103 TGCCTCCCTCATGAGGGTGGGGG - Intronic
1147957036 17:44141898-44141920 TGCCTGCCCCTTTAAGAAGGCGG + Exonic
1149481819 17:57009611-57009633 TGCCTGCCTCATAATAAAAGTGG - Intergenic
1149660400 17:58331663-58331685 TGGCTGCCTCATTTGGACGCTGG - Intergenic
1150137107 17:62702098-62702120 TCCCTGCCAAATTAGGAAGCGGG - Intronic
1151677048 17:75603967-75603989 TGGCTGCCTCAGAAGGGAGGGGG + Intergenic
1152723113 17:81932515-81932537 TGTCTGCCACATGAGGAGGGAGG - Intronic
1153604411 18:6817380-6817402 AACCTGCCTCGTAAGGAAGGTGG - Intronic
1155870082 18:31016396-31016418 TGCCTGCATCAGGAGGAAGAGGG + Intronic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1160572282 18:79826266-79826288 TGCCTGCCTCAGAAGGGAGCAGG - Intergenic
1162932120 19:13962535-13962557 TGCCGGCCCCATAAGGGAGGAGG + Exonic
1165856282 19:38880816-38880838 TGCCTCCCTCATCAGCAAGTAGG - Exonic
1168414806 19:56161086-56161108 TCCCTGCCTCCGTAGGATGGAGG - Intergenic
926087680 2:10030245-10030267 TGCCTGCCTTAGGAGGTAGGAGG + Intergenic
927473760 2:23396538-23396560 TGCATACCTCATTTGGAAGCTGG + Intronic
928637145 2:33258432-33258454 AGCCTGCCTCACCAAGAAGGCGG - Intronic
932416685 2:71577822-71577844 TCCCTGCCTCCTGGGGAAGGTGG + Intronic
933526309 2:83444783-83444805 TGCATGCCTCTTTGGGAAGCTGG + Intergenic
933774869 2:85765806-85765828 TGCCTGGCTGGTGAGGAAGGAGG + Intronic
934659143 2:96133905-96133927 CACCTGCCGCATTAGGAAGAAGG + Intronic
935874257 2:107488758-107488780 TGCCTGCCTCTGCAGGGAGGGGG + Intergenic
937323265 2:120973529-120973551 TCCCTGACTCATTTGTAAGGTGG + Intronic
937969967 2:127541899-127541921 TGACTGCCTCCTAAGGAAGCTGG + Intronic
937982522 2:127623857-127623879 TGTCTGCCTCCTTAGGGAAGGGG + Intronic
940916580 2:159262961-159262983 TACCTGCCTCATGAGGAAACTGG - Intronic
945040521 2:205740106-205740128 TGCCTGCAACATGAGGAAGAGGG + Intronic
948675917 2:239596635-239596657 CTCCTACCTCATGAGGAAGGAGG + Intergenic
948883137 2:240870496-240870518 TGCCTGCCTGAAGAGGAGGGTGG - Intronic
1169111802 20:3038890-3038912 AGCCTCCCTCCCTAGGAAGGTGG + Intronic
1171486934 20:25491897-25491919 TGCCTCCCTCCTTGGGAGGGAGG - Intronic
1172829303 20:37819426-37819448 TACCTGCCTCATTATGAATAGGG + Intronic
1173577233 20:44120425-44120447 TGCCTGGCCCATTAGGAAATTGG - Intronic
1174539395 20:51277084-51277106 TGTCAGCCTCATTAAAAAGGAGG - Intergenic
1180183346 21:46127642-46127664 TCCCTGCCCCATCAGGAACGAGG - Intronic
1180831344 22:18908105-18908127 TGCCTGCCTTCTGGGGAAGGGGG - Intronic
1181068514 22:20318261-20318283 TGCCTGCCTTCTGGGGAAGGGGG + Intronic
1181761044 22:25059034-25059056 TGCCTCCCTCATCAGGGTGGAGG + Intronic
1183517268 22:38273851-38273873 TGCCTGCCTTATTGGGTAGCGGG - Intergenic
1183710322 22:39499591-39499613 AGCCTGTCTCATTTGAAAGGTGG - Intronic
1203281428 22_KI270734v1_random:133376-133398 TGCCTGCCTTCTGGGGAAGGGGG - Intergenic
952580944 3:34832692-34832714 TGACTGCCTCTTTGGCAAGGTGG + Intergenic
954832143 3:53430615-53430637 TCACTGCCTCATTAGGAAGCAGG - Intergenic
955932493 3:64071569-64071591 GGACTGCCTCATCTGGAAGGAGG - Intergenic
955948305 3:64216826-64216848 TGCCTGCCTCATTAGGAAGGAGG - Intronic
956199353 3:66690348-66690370 TGCTTTCCTCATCAGTAAGGTGG - Intergenic
958031847 3:88120407-88120429 AGACTGCCTTATTAGGAATGGGG + Intronic
960229523 3:115208866-115208888 TACCTTACTCATTAAGAAGGAGG - Intergenic
960230892 3:115226155-115226177 TGCCTGGCTCATAAGGAGTGGGG - Intergenic
966537834 3:181054001-181054023 TGATTGCCTCAATAGGAGGGTGG - Intergenic
967455891 3:189686298-189686320 TGCCAGCTTCAGTATGAAGGAGG - Intronic
970669600 4:18380731-18380753 AGGCTGCCTCATTATAAAGGGGG - Intergenic
971278871 4:25224586-25224608 TTCCTGCCTCACTACAAAGGAGG + Intronic
972377791 4:38489272-38489294 TGCCTTCTTCATTAGCATGGAGG + Intergenic
974117779 4:57601437-57601459 TTCCTGCCTCTAGAGGAAGGAGG + Intergenic
979428281 4:120594953-120594975 TGTCTCCCTCAATAGGAATGAGG - Intergenic
981042262 4:140234065-140234087 AGCCAGCTTCATTACGAAGGGGG + Intergenic
985868450 5:2534746-2534768 GGCATGCCTCCCTAGGAAGGTGG - Intergenic
986240921 5:5959223-5959245 TGTATGCCTTATTATGAAGGGGG - Intergenic
992136528 5:73751656-73751678 TACCTTCCTCCTAAGGAAGGAGG - Intronic
992710848 5:79454366-79454388 TGCCTCCTTTATTAGAAAGGAGG - Intronic
993558737 5:89376508-89376530 TGCCTCCTACATAAGGAAGGTGG + Intergenic
995072484 5:107940695-107940717 TGCCTTGCTCCTTAGTAAGGAGG + Intronic
996010055 5:118472317-118472339 TGCCCTCCTCATAGGGAAGGTGG - Intergenic
1001054022 5:168434734-168434756 TGCCTGCGATATTGGGAAGGTGG - Intronic
1004606342 6:17198557-17198579 CTCCTGCCTCAGTAGGAAGCAGG + Intergenic
1006586827 6:35120521-35120543 TGGCTGCCTCATTGGGAGAGGGG + Exonic
1007017303 6:38481614-38481636 TGCCAGCCTCATTAGGGGAGAGG - Intronic
1008012931 6:46488311-46488333 TGCCTGCCTCATAAGGTTAGTGG + Intronic
1008436712 6:51484908-51484930 GGCCTGCCTCACTAGGTTGGGGG + Intergenic
1008772029 6:54990952-54990974 TGTCTGGCTCAGTAGGAAGTGGG + Intergenic
1008917573 6:56806009-56806031 TGCAAACCTCATTAGGATGGGGG + Intronic
1010042873 6:71407530-71407552 TGCCAGCCAAAGTAGGAAGGAGG - Intergenic
1012551826 6:100470119-100470141 TTCCTGCCTCCTTAGGAAAGTGG + Intergenic
1014514501 6:122363649-122363671 ACCATGCCTCATTAGGAATGGGG - Intergenic
1015040939 6:128718052-128718074 TACCTGTCTCAGTAGGATGGTGG - Intergenic
1017223966 6:151998493-151998515 TGCTAGACTCACTAGGAAGGAGG - Intronic
1017657779 6:156646331-156646353 TGCCTACCTCATTGGGCAGATGG - Intergenic
1019919617 7:4155121-4155143 TGCCTGCCTCATTTGGGCAGTGG + Intronic
1025068607 7:55879484-55879506 GGCCTGCTTCATTAAGAAGCTGG + Intergenic
1027600434 7:80233480-80233502 TACCTTCCTGATTAGCAAGGGGG - Intergenic
1028467208 7:91166093-91166115 TGCCTGCTTCCCTAGTAAGGAGG + Intronic
1028614191 7:92746770-92746792 TGCTTGCCTCAATATGATGGGGG + Intronic
1030665330 7:112271646-112271668 TGCCTGCCTGCTAAGGCAGGTGG - Intronic
1031457683 7:122003726-122003748 TGCCTGGGTCATTAGGAAAATGG - Intronic
1031715156 7:125099955-125099977 TGCCTGACCAATTAGGATGGAGG + Intergenic
1033643771 7:143286016-143286038 AGCCAGCCCCAGTAGGAAGGAGG - Exonic
1035185788 7:157125185-157125207 TGCCTTCCTCCCGAGGAAGGAGG + Intergenic
1037381686 8:18292140-18292162 AACCTGCCTCATCAGGAAGCTGG + Intergenic
1037817221 8:22118619-22118641 TGCCTGCCTCATGGGGCGGGGGG + Intronic
1039437956 8:37573564-37573586 TGCCTGCCTTTCTGGGAAGGAGG + Intergenic
1042674931 8:71309752-71309774 TCCCTGCCTCATTATGAAGTGGG - Intronic
1045211789 8:100106497-100106519 TGCCGGCCTCCTGAGGAATGAGG - Intronic
1045640159 8:104240928-104240950 AGCCTACCTCATTAGGAATGAGG - Intronic
1046198323 8:110891312-110891334 ACCGTGCCTCATTAGGAATGGGG + Intergenic
1050212617 9:3279720-3279742 TGTCTGCTTCCTTAGGAAGATGG + Intronic
1052750613 9:32485870-32485892 TGCCCGCCTCATCAGAGAGGAGG - Intronic
1057548818 9:96037383-96037405 TGCCTGAGTCAGCAGGAAGGAGG + Intergenic
1059588114 9:115628007-115628029 TGATTGCCCCATTAGGAATGGGG + Intergenic
1203788188 EBV:139590-139612 TGCCAGCCCCATTGGGGAGGGGG + Intergenic
1193108578 X:77704940-77704962 TGCCTGCCCCATAAAGCAGGAGG + Intronic
1198534573 X:137574032-137574054 TCCCAGCCTCATTAGGCCGGCGG + Intronic
1199483155 X:148320551-148320573 AGCCTGCCTCATTAAGAAAATGG + Intergenic