ID: 955949413

View in Genome Browser
Species Human (GRCh38)
Location 3:64227002-64227024
Sequence CTTCAGGAACTGCAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 279}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955949413_955949419 8 Left 955949413 3:64227002-64227024 CCTTCCAGCTGCAGTTCCTGAAG 0: 1
1: 0
2: 0
3: 31
4: 279
Right 955949419 3:64227033-64227055 GAATTTCTTTGTTGGATGTGGGG 0: 1
1: 0
2: 1
3: 40
4: 328
955949413_955949418 7 Left 955949413 3:64227002-64227024 CCTTCCAGCTGCAGTTCCTGAAG 0: 1
1: 0
2: 0
3: 31
4: 279
Right 955949418 3:64227032-64227054 TGAATTTCTTTGTTGGATGTGGG 0: 1
1: 0
2: 2
3: 41
4: 419
955949413_955949416 0 Left 955949413 3:64227002-64227024 CCTTCCAGCTGCAGTTCCTGAAG 0: 1
1: 0
2: 0
3: 31
4: 279
Right 955949416 3:64227025-64227047 CTTCAAATGAATTTCTTTGTTGG 0: 1
1: 0
2: 5
3: 31
4: 367
955949413_955949417 6 Left 955949413 3:64227002-64227024 CCTTCCAGCTGCAGTTCCTGAAG 0: 1
1: 0
2: 0
3: 31
4: 279
Right 955949417 3:64227031-64227053 ATGAATTTCTTTGTTGGATGTGG 0: 1
1: 0
2: 3
3: 25
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955949413 Original CRISPR CTTCAGGAACTGCAGCTGGA AGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900745086 1:4355645-4355667 CTTCCTGAACTGCAGTGGGAAGG - Intergenic
900903739 1:5535820-5535842 CTGCAGAAACATCAGCTGGATGG + Intergenic
901168565 1:7237167-7237189 CTCCAGGAACAGTATCTGGATGG - Intronic
903031453 1:20466904-20466926 CTTCAGGAGGGACAGCTGGATGG - Intergenic
903632786 1:24789191-24789213 CTTCAGGAATGGCAGTTAGATGG + Intronic
903780138 1:25815657-25815679 CTTCAGGAACTGCATGTAGGTGG - Exonic
903996368 1:27307555-27307577 CCCCAGGGGCTGCAGCTGGAGGG - Exonic
904937328 1:34140935-34140957 CTGCAGGAAGTGAGGCTGGAGGG - Intronic
905875437 1:41429054-41429076 CTTCAGGATCTGCAGGGGAAAGG + Intergenic
906529746 1:46516973-46516995 TTTCTTGAAATGCAGCTGGAGGG - Intergenic
906541856 1:46592909-46592931 ATTCAGGAAGTGGAGCTGGCTGG + Intronic
906593428 1:47049994-47050016 CTTCAGGAACTGCATTGGGCAGG + Exonic
908617396 1:65937450-65937472 CTTTAGGATCTGCAGCTGAGAGG - Intronic
908785567 1:67731499-67731521 CTGCAGGATCTGGAGCTAGAAGG + Intronic
909981811 1:82111854-82111876 TTTAGGGAACTGCAGATGGATGG + Intergenic
911223516 1:95277947-95277969 CTTCAGGAAATGCTGCTGATTGG - Intergenic
912385751 1:109270445-109270467 GTACAGGAAGTGCAGCAGGATGG - Exonic
914688990 1:150009180-150009202 CTTCAGGGACGGAAGCTGGGTGG - Intronic
915321169 1:155057206-155057228 CTTCAGCAACTGCAGCCGACGGG + Exonic
917088607 1:171329113-171329135 GGTCAGAAACTGCAGCTGGTAGG - Intronic
917927081 1:179798414-179798436 TTTCAGGAGCTGCCTCTGGATGG + Intronic
919013937 1:192004300-192004322 GTTCAGGGTCTGCAGCAGGATGG - Intergenic
920053948 1:203179571-203179593 CTTCAGGTACTGCACCTGGCAGG + Exonic
920192362 1:204201797-204201819 CGTCAGGAACAGCAGCTGTAGGG + Exonic
920787937 1:209060555-209060577 CTTTGGGAAATGCTGCTGGAGGG + Intergenic
922011313 1:221591243-221591265 CATCAGGTATTGCATCTGGAGGG - Intergenic
1062977195 10:1692989-1693011 CTTCAGGACTAGCACCTGGAGGG - Intronic
1063099195 10:2934877-2934899 CTTCAGGAACTGAAGCGGTGAGG + Intergenic
1063169481 10:3494785-3494807 CTTTAGGAACTGAAGCTTGAGGG + Intergenic
1064015506 10:11768898-11768920 CTTCTGGCTCTCCAGCTGGAAGG - Intergenic
1065329100 10:24574979-24575001 TATCAGGAGCTGCAGCTGGAGGG + Intergenic
1066298264 10:34075096-34075118 CTGCAGGAACTGCAGCTATGAGG - Intergenic
1066671507 10:37845128-37845150 CCTCAGGAAGTTCAGGTGGAAGG - Intronic
1067429834 10:46235816-46235838 CTTCAGCACCTGTGGCTGGAGGG + Intergenic
1067443808 10:46328002-46328024 CTTCAGCACCTGTGGCTGGAGGG - Intronic
1069661101 10:70123983-70124005 GTTCAGGGCCTGCAGCTGGCTGG + Exonic
1070838806 10:79468963-79468985 CCTCAGGAACTAAAGCTGCAGGG + Intergenic
1071329779 10:84548054-84548076 CTTCAGCAGCTACAGCTGGTGGG + Intergenic
1072750887 10:97977914-97977936 CATCAGGAACAGCAGCAGGCTGG - Intronic
1073177073 10:101563179-101563201 CTTCAGGAAGGGTAGCTGGCAGG + Intergenic
1073912597 10:108363782-108363804 CAGCAGGAACAGCAGCTGGGGGG + Intergenic
1076591462 10:131586596-131586618 CTCCAGGAACTTCAGCTCAATGG + Intergenic
1077313839 11:1906896-1906918 CTTCACGAACTTCAGCTGCCTGG + Intergenic
1079427125 11:20354253-20354275 CTTCAGGAGCAGGAGCTGAAGGG - Intergenic
1081044219 11:38251146-38251168 AGTCTGGAACTGCAGCTGGCTGG + Intergenic
1081763786 11:45595170-45595192 CTTCAGAAAAGGCAGCTGGAGGG - Intergenic
1083101261 11:60308646-60308668 CTTCAGGAAGTGGAGATGCATGG + Exonic
1083443206 11:62690365-62690387 CTTCAGGAACTAGAGCAGGTGGG + Exonic
1083868329 11:65470945-65470967 CTGCAGGAACTGAAGAGGGAGGG - Intergenic
1084693506 11:70740447-70740469 CTTCAGGAACTCAAGGTGGAGGG - Intronic
1085706894 11:78794513-78794535 GTACAAGAACTGCAGCTGGGAGG + Intronic
1086865557 11:91975886-91975908 CTTGAGTTACTGGAGCTGGAAGG - Intergenic
1088227039 11:107632434-107632456 TTACAGGAACTGTAGCTGAAGGG + Intronic
1088590230 11:111396422-111396444 CTGCTGGAACTGCAGCAGAATGG - Intronic
1089749895 11:120643521-120643543 CTGCTGGACCTGCAGCTGAATGG + Intronic
1093480267 12:19597396-19597418 CTTCCGTAACTGCAGATGGGTGG + Intronic
1094352052 12:29537766-29537788 CCTCAGAAACTGGAGCTGTAGGG - Intronic
1096025714 12:48359310-48359332 CATAAGGCACTGCTGCTGGAAGG + Intergenic
1096494239 12:52030124-52030146 CTTCAGGGAATGCTGCTGCAGGG + Intronic
1096529781 12:52235284-52235306 CTTGAGGCACTGCAGGTGGATGG + Exonic
1096563018 12:52450606-52450628 CTCTAGGAACCGCACCTGGAGGG + Exonic
1096565170 12:52472266-52472288 CTCTAGGAACCGCACCTGGAAGG + Exonic
1096570281 12:52519146-52519168 CTCCAGGAACCGCACCTGGAGGG + Exonic
1097702896 12:62838581-62838603 CATCAGCAAATCCAGCTGGATGG + Intronic
1098231463 12:68375697-68375719 CTCCAGGATCTCCAGCTTGAAGG - Intergenic
1099976139 12:89547105-89547127 CTTCAGGAAGTACATCTGGTTGG - Intergenic
1100167870 12:91938704-91938726 CTTCAGGAATTGGAGAGGGAAGG - Intergenic
1102845981 12:116182822-116182844 CTGCAGGAACTTCAGGTGGGAGG - Intronic
1103590552 12:121989434-121989456 CTCCAGGAACTAGATCTGGATGG - Intronic
1103760046 12:123242645-123242667 CTTCTTGAACTCCAGCTGGGTGG + Intronic
1104642586 12:130476839-130476861 CTTCTGGAACAGCAGCTGAGTGG + Intronic
1105300321 13:19128092-19128114 GTTGAGGAAATGCTGCTGGATGG + Intergenic
1105519186 13:21116273-21116295 CTTCAGGGACTGCAGGGGGATGG - Intergenic
1108409333 13:50131068-50131090 ATTCAGCAACTGCAGCAGGTAGG - Intronic
1109198889 13:59409423-59409445 TTTCAGGCCCTGCAGCTGGGAGG - Intergenic
1113000030 13:105624631-105624653 CTTCAGGATCTGCAGGTGCTGGG + Intergenic
1117379526 14:55146636-55146658 CTACAGGAAGTGCTGCTGGCAGG - Intergenic
1117932851 14:60863425-60863447 CTTCAGCAAATGCAGCTGATTGG + Intronic
1118302217 14:64625940-64625962 CTTCTGGATCTGGAGCAGGAGGG + Intergenic
1121215301 14:92242914-92242936 CTTTAGGAAATACAGCTGGGTGG - Intergenic
1122318540 14:100839742-100839764 CTGCAGACACTGCAGCAGGAGGG + Intergenic
1125270431 15:37933068-37933090 CTTTAGGAACAAGAGCTGGAGGG - Intronic
1125549750 15:40536574-40536596 CTACAGGCCCTGCAGCAGGAGGG + Intronic
1126377128 15:48007713-48007735 CTTGAGGATCTGCATCTGGCTGG - Intergenic
1126583995 15:50265528-50265550 CTGCAGGAACGGCTGCTGGTGGG - Intronic
1128528209 15:68426699-68426721 CTTCAGGAAATGGAACTTGAGGG - Intronic
1128818854 15:70634325-70634347 CTTAAGGAGAAGCAGCTGGAGGG + Intergenic
1128859329 15:71052364-71052386 GTTCTGGTACAGCAGCTGGATGG + Intronic
1129846735 15:78771289-78771311 CTCCTGGAACAGCAGCTGGGTGG + Exonic
1129917741 15:79289262-79289284 CTTAAGGAACTTCAGATGGGAGG + Intergenic
1130255163 15:82322602-82322624 CTCCTGGAACAGCAGCTGGGTGG - Intergenic
1130599811 15:85267404-85267426 CTCCTGGAACAGCAGCTGGGTGG + Intergenic
1131431791 15:92394063-92394085 GCTCCGGAACTGCAGCTGCATGG - Exonic
1133040635 16:3058429-3058451 TTCCAGGACCGGCAGCTGGAGGG + Exonic
1135085875 16:19474111-19474133 CTTCAGGAACTGCAGGGGATGGG - Exonic
1136775752 16:32870911-32870933 CTTGAGGAACCGCAGCTTGGTGG + Intergenic
1136894865 16:33990601-33990623 CTTGAGGAACCGCAGCTTGGTGG - Intergenic
1137981288 16:53072215-53072237 CTGCAGGAGCAGCAGCTGGAGGG - Intronic
1139151599 16:64388344-64388366 CTTCAGGGACAGCAGCTTTAAGG + Intergenic
1139393434 16:66621202-66621224 CTTCATGAACCGCAGGTGGGAGG - Intronic
1140523668 16:75603972-75603994 CTTCAGGAATTGCTGCTTAAAGG + Intronic
1140685032 16:77425310-77425332 CATCAGGAATTGAGGCTGGAGGG + Intronic
1141181070 16:81753830-81753852 CTCCAGGAGAAGCAGCTGGAGGG + Intronic
1141452964 16:84117667-84117689 CTTCAGGTACTGCTGGTGGGCGG + Intergenic
1203078168 16_KI270728v1_random:1133020-1133042 CTTGAGGAACCGCAGCTTGGTGG + Intergenic
1142631518 17:1229247-1229269 CTGCAGGAGCTGCCGGTGGACGG + Intergenic
1143524549 17:7464459-7464481 CTGAAGGAACTGGGGCTGGAGGG + Intronic
1143783075 17:9239640-9239662 CTTCAGGATGTGGATCTGGACGG - Exonic
1144677688 17:17172479-17172501 CTTCATGAACTCCCCCTGGAAGG - Intronic
1144703766 17:17354309-17354331 CTTCAGGAGCTTCAGCAGGCAGG + Intergenic
1147999050 17:44377008-44377030 CCTCCGTATCTGCAGCTGGAAGG + Exonic
1148772758 17:50076576-50076598 CTTCTGGAACTGGACCTGGGGGG - Exonic
1148908260 17:50925478-50925500 CTTGTGAAACTGCAGCTGGCTGG + Intergenic
1152208741 17:78991465-78991487 CCTAAGGACATGCAGCTGGATGG + Intergenic
1158859067 18:61574393-61574415 CTTCACGAGATGGAGCTGGAAGG - Intergenic
1160195878 18:76755053-76755075 CTTCAGGATCTGCAGCTCACAGG - Intergenic
1163193473 19:15696902-15696924 CTGCAGGAACTGCATCGGGCAGG + Exonic
1163462124 19:17445315-17445337 GTTCAGGAAGTGGAGCTGGTGGG + Intronic
1163493349 19:17630280-17630302 CTGCTGGAACTGCAGGGGGAAGG + Exonic
1164443774 19:28300017-28300039 CTTCAGGAAATCCAGCAGGCAGG - Intergenic
1164614145 19:29656073-29656095 CTGCAGGAACTGCAAATGCAAGG + Intergenic
1165808358 19:38595883-38595905 ATCTAGGGACTGCAGCTGGAGGG + Intronic
1165973956 19:39658072-39658094 CTCCAGGACCTGCACCTGCATGG - Intronic
1165976575 19:39681619-39681641 CTCCAGGACCTGCACCTGCATGG - Intergenic
1167119351 19:47507454-47507476 CTTCGGGAGCTGCAGGTGGTGGG - Intronic
1167356983 19:49010372-49010394 CTCCAGGAAATGGAGCTGGGAGG - Intronic
1167503521 19:49860128-49860150 CTGCAGGACCTGCTGCTGGTTGG - Exonic
925197656 2:1939788-1939810 CTGCAGGTACTCCAGCTGGATGG - Intronic
925309771 2:2874382-2874404 CGTCTGGCTCTGCAGCTGGAAGG + Intergenic
927217429 2:20675934-20675956 CAGGAGGAACTGCAGCTGGATGG - Intergenic
927466680 2:23341916-23341938 CTTTAGGACCTGAACCTGGAGGG - Intergenic
929670762 2:43875237-43875259 CAGCAGGAAGTGCAGCAGGAAGG - Exonic
929887002 2:45887895-45887917 TATCTGGAACTGCAGCTGCAGGG + Intronic
930186325 2:48415539-48415561 CTTCAGGAACCTCAGCTGGCTGG + Intergenic
930877855 2:56239768-56239790 CTCCAGTAACTGCCACTGGAAGG - Intronic
931591781 2:63891960-63891982 CTTCAGGAAATGAAGCTTCAGGG - Intergenic
931811506 2:65858911-65858933 TTTCAGGAAATGAAGATGGATGG - Intergenic
933981779 2:87556355-87556377 CTTCAGGAACATCAGCTCCACGG - Intergenic
934804519 2:97206722-97206744 CTTCAGGAACTGCTGGAAGAAGG + Intronic
936312057 2:111394462-111394484 CTTCAGGAACATCAGCTCCACGG + Intergenic
936762854 2:115806841-115806863 CTTCAGGAACTGGGGGTGGGGGG - Intronic
937152241 2:119693773-119693795 CTTCTGTGACTGCAGCTGGTGGG - Intergenic
937396959 2:121545614-121545636 CTGCAGGAAATGCAGATAGAGGG - Intronic
938289081 2:130140082-130140104 CTTGAGGTGCTGCAGCTGAAAGG + Exonic
938939002 2:136152813-136152835 TTTCCAGAACTGCAGTTGGAAGG - Intergenic
940038195 2:149331077-149331099 CACCAGGAACTCCAGCCGGAGGG + Intronic
944402911 2:199348851-199348873 GTTCAGGAACTGCTGGTTGATGG + Exonic
945314021 2:208350999-208351021 CCTCAGAAAATGCAGCAGGAAGG + Intronic
946212703 2:218160288-218160310 CTGCAGGGATTGGAGCTGGAAGG + Intergenic
948619219 2:239223529-239223551 GTTCAGGAACTGAGGCTGGGAGG - Intronic
1170386811 20:15827912-15827934 TCTCAGGAATTTCAGCTGGATGG + Intronic
1170907401 20:20528476-20528498 ATTCAGGAAGTACAGCTGGCAGG + Intronic
1171986017 20:31661806-31661828 GGTCAGGAGCTCCAGCTGGAGGG - Intergenic
1173643108 20:44617147-44617169 CTCCAGGGTCTGCAGATGGATGG - Intronic
1175234802 20:57502466-57502488 CTTGAGGAAAGGCAGGTGGAGGG + Intronic
1175895556 20:62334212-62334234 GTTCGAGAACTTCAGCTGGAGGG - Exonic
1177397670 21:20558372-20558394 CTTCAGAAACTACAATTGGATGG - Intergenic
1179140796 21:38723161-38723183 CTTCAGAATCTACAGCTGAAAGG - Intergenic
1179251027 21:39671553-39671575 CTTCAGGAACTGATGTTTGAAGG - Exonic
1180927733 22:19567677-19567699 TTTCAGGACCTGCAGATGAAGGG - Intergenic
1181086471 22:20441837-20441859 CTGCAGGAACTGCTTCTGAAAGG - Exonic
1181108367 22:20587732-20587754 CTTGAGGTGCTGCAGCTGAAAGG + Intergenic
1181636010 22:24175232-24175254 CCTCAGGCAGAGCAGCTGGATGG + Intronic
1181968222 22:26671365-26671387 CCTCTGAAGCTGCAGCTGGAGGG + Intergenic
1182320731 22:29477296-29477318 CTCCAAGAACTGCGGGTGGATGG + Intergenic
1182459137 22:30471874-30471896 CTTCCGGAACTCCAGGGGGAGGG + Intronic
1182555010 22:31124475-31124497 CTTCAGGGACTGCAGTGGGAGGG + Intronic
1182943831 22:34303519-34303541 CTTCAGGAAACTCAGCTGCAAGG + Intergenic
1183026742 22:35071019-35071041 CTTGATGAACTGCAGCATGAGGG - Intronic
1183931483 22:41238284-41238306 CTGCGGGAGCTGCTGCTGGACGG - Exonic
1184411121 22:44327111-44327133 CCCCAGGAACTGCTGGTGGAGGG - Intergenic
1184763717 22:46560895-46560917 TTTCAGGAAGTGCAGCTTGATGG + Intergenic
1184950966 22:47842357-47842379 GCTCAGGAACTGCATCAGGAGGG + Intergenic
950630100 3:14276621-14276643 CTGCAGGGACTCCAGCTGCAGGG - Intergenic
952505170 3:34000594-34000616 CTTTAGGCTCTGCAGCTGCAAGG + Intergenic
953793814 3:45967777-45967799 CTCCAGGAACTGCAGCTGCCGGG + Exonic
955949413 3:64227002-64227024 CTTCAGGAACTGCAGCTGGAAGG - Intronic
958695880 3:97526816-97526838 CTTCAGGACCTGCTGTGGGATGG + Intronic
958996833 3:100915169-100915191 ATCCTGGAACTGCTGCTGGAGGG - Intronic
960687410 3:120307888-120307910 CTGCAGGACCTGCTGCTGGTAGG - Intergenic
960844387 3:121993310-121993332 CTCCAGGAACTGAGGCCGGAGGG + Exonic
961357972 3:126350958-126350980 CATCAGGAACTGCAGAGGGCTGG + Intronic
961547833 3:127647789-127647811 CTTCAGGAACAGTCACTGGATGG + Intronic
962127930 3:132642006-132642028 ATACAGTCACTGCAGCTGGAAGG - Exonic
962318145 3:134371314-134371336 CCTCAGGGCCTGCTGCTGGATGG + Exonic
962367734 3:134796985-134797007 CTTCTGGAAGTGAAGCTGGAGGG + Intronic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
964199713 3:154105464-154105486 CTGCAAGCACTGCAGCTGGCAGG - Intergenic
966928417 3:184660240-184660262 CTCCAGGCCCTGCAGCAGGAGGG - Intronic
968649307 4:1754100-1754122 CTTCAGGCACTGCTTCTGGCAGG + Intergenic
969600928 4:8176009-8176031 CTCCAGAAAATACAGCTGGAAGG + Intergenic
969831903 4:9804720-9804742 CTTCAAGAGTTGCAGCAGGACGG + Intronic
969928002 4:10603494-10603516 CCTCAGGAACTGCCGCAGGTTGG + Intronic
970667818 4:18358176-18358198 CTTCAGGATTTGCAGATGGTGGG + Intergenic
972167776 4:36308379-36308401 CTTAAGGACCTGCACTTGGAAGG + Exonic
972350106 4:38228835-38228857 CTTCTGGAACTGTGGGTGGAGGG + Intergenic
973763343 4:54140537-54140559 CTCCTGGAACTGGAGGTGGAGGG - Intronic
973789709 4:54366721-54366743 TTTCAGGATTTGCTGCTGGAAGG - Intergenic
973929945 4:55782062-55782084 CTGCAGGGCCTGCAGCTGGGTGG - Intergenic
975637532 4:76464857-76464879 CTACAGGAAGCACAGCTGGAAGG - Intronic
976771463 4:88657816-88657838 CTTCTGGAACTGCACCTTGGTGG - Intronic
976859267 4:89643468-89643490 CTTCAGAAACTGCATTTGAAAGG + Intergenic
978764646 4:112391655-112391677 CTTCTTGATCTGCAGCTGTATGG - Intronic
979506284 4:121501472-121501494 CTCCAGGGCCTGCAGCTGGGTGG + Intergenic
979926432 4:126571347-126571369 CTCCAGTAATTGCAGCTGGCTGG + Intergenic
981991432 4:150925594-150925616 CTTGAGAAACTACAGATGGAAGG + Intronic
982225878 4:153165987-153166009 CTTCTGGAACTCCAGTTGGCTGG + Intronic
982331599 4:154187168-154187190 CTTCAGGGACTCCACCTGCATGG - Intergenic
982778352 4:159465323-159465345 CTTCAGGATCTGCTGTGGGATGG + Intergenic
984521045 4:180801294-180801316 CTTGAGAAACAGCAGCTGGAAGG + Intergenic
986032571 5:3908094-3908116 CTTTAGGAACTTCTCCTGGATGG - Intergenic
986583230 5:9287107-9287129 CTGGAGGAAGTGCAGGTGGACGG - Intronic
987206749 5:15635299-15635321 CTTCAGAGACTCCAGCAGGATGG + Intronic
987554612 5:19431042-19431064 CTTCAGGGACTGAAGGGGGATGG - Intergenic
992196479 5:74344593-74344615 CTTCAGGAAGGGAAGCTAGAAGG + Intergenic
992521944 5:77562882-77562904 AATCAGGAATTGCATCTGGAGGG - Intronic
992667108 5:79021274-79021296 TTTCAGGAACTAAAGCTGTAGGG - Intronic
995630765 5:114129579-114129601 CTTCTGTAACTTCAGCTGGATGG + Intergenic
996644641 5:125799031-125799053 CTTAAGGAATAACAGCTGGAGGG + Intergenic
997559135 5:134829966-134829988 ATTCAGGAACTGTATCTTGAAGG - Intronic
997569814 5:134917702-134917724 TTTCTGGAGCTGCAGCGGGAGGG + Intronic
997719614 5:136067036-136067058 CTCCAGGACCTGGAGGTGGAAGG + Intergenic
999399452 5:151253209-151253231 CATCAGGGACTGCATCGGGAAGG - Exonic
1000686483 5:164255810-164255832 CTTAAGGAACTGCACCTGGGTGG - Intergenic
1001043309 5:168352503-168352525 CCTTAGGTCCTGCAGCTGGAAGG - Intronic
1003114842 6:3276941-3276963 CTTCGGGAAGTGAAGCTGGTGGG - Intronic
1003623421 6:7722618-7722640 CTTCAGGAAATGCAGTTGAAAGG + Intergenic
1003692436 6:8367858-8367880 CTTCAGAAAGTGCACCTGGGAGG - Intergenic
1004288615 6:14346227-14346249 CTGCAGGCACTGCCCCTGGAAGG + Intergenic
1004313434 6:14565689-14565711 CTGCAGGTACTGCACCTGGAGGG - Intergenic
1005152183 6:22764797-22764819 TTTAGGGAATTGCAGCTGGAAGG - Intergenic
1005710548 6:28500106-28500128 CTTCAGGGACAGCCACTGGAAGG + Intergenic
1006888326 6:37400765-37400787 CTGGAGAAAATGCAGCTGGATGG + Intergenic
1007345216 6:41223905-41223927 CTTCCCAAACTGCAGCTGGAGGG - Intergenic
1007397708 6:41587031-41587053 TTGCAGGAGCTGCTGCTGGAAGG - Exonic
1008463908 6:51808323-51808345 CTTCAGGAAATGAAACTGGCTGG + Intronic
1011079403 6:83473049-83473071 TTCCAGAAGCTGCAGCTGGATGG + Intergenic
1011804750 6:91059837-91059859 CTTCAGGATCTGCAGTGGAAAGG + Intergenic
1012008181 6:93743364-93743386 CTTCAGGAACCTCAGGTGGAAGG + Intergenic
1012170925 6:96015962-96015984 CTACAGCTACTGCCGCTGGAGGG - Exonic
1012310689 6:97720598-97720620 CTTCAGTTCCTACAGCTGGAGGG + Intergenic
1015705162 6:136080016-136080038 CTAGAGGAACTGCAGGTGGGTGG - Intronic
1017445171 6:154501272-154501294 ATTCAGGAAATCCAGCTGGAAGG - Intronic
1017671506 6:156773679-156773701 CTGCAGGAAATGCTGCGGGATGG + Intergenic
1017827894 6:158095901-158095923 CTGCAGGACCTGCAGGTGGAAGG - Exonic
1018818733 6:167356254-167356276 CTTCAGGAGCAGCACCTGGGTGG + Intronic
1019107675 6:169682214-169682236 CTTCAGGATCTGCTGTGGGATGG - Intronic
1022555798 7:31294746-31294768 CTTCAGGAACTCCAGTTACATGG + Intergenic
1026431821 7:70355475-70355497 CTTCAGGAACTGGAACTGAGAGG - Intronic
1029223899 7:99011298-99011320 CTTTAGGAACTTCAGCAGAAAGG - Intronic
1029458578 7:100683082-100683104 CTCCTGGAGTTGCAGCTGGAGGG - Exonic
1030271395 7:107672151-107672173 CGACAGGAACTGCAGCTAGTAGG - Exonic
1031475793 7:122220003-122220025 TTCCAGGAACTGCATCTTGAAGG - Intergenic
1034345460 7:150382734-150382756 CAGCAGGAGCTGCAGCTGGCTGG - Intronic
1035548194 8:499815-499837 CTTCAGGAACTCCACCTCAAGGG - Intronic
1040124416 8:43720779-43720801 CTTATGGAGCTGCAGCTGGTGGG + Intergenic
1040602641 8:48899299-48899321 TCTCAGGGACTGCAGCTGGGTGG - Intergenic
1041958664 8:63585995-63586017 CATCAAGAACTGCAGCTGCGAGG + Intergenic
1045394763 8:101749898-101749920 CTTCTGGCATAGCAGCTGGATGG + Intronic
1046891195 8:119422876-119422898 GTTCTTGAACTGCAGGTGGATGG - Exonic
1047140634 8:122134997-122135019 CAACAGAAACTGCAGCAGGAAGG + Intergenic
1048444954 8:134486299-134486321 CTTCGGGAATTCCAGCTGGGTGG + Intronic
1048920229 8:139222746-139222768 ATTCAGAAACTGTTGCTGGATGG + Intergenic
1049100766 8:140577593-140577615 CTTGAGGAGGAGCAGCTGGAGGG + Intronic
1049278145 8:141730207-141730229 CTTCAAGGGCTGCAGCTGGTGGG - Intergenic
1049519624 8:143081236-143081258 CTTCAAGGTCAGCAGCTGGACGG + Exonic
1049811636 8:144577101-144577123 CTTTGGGAAATGCCGCTGGAGGG + Intronic
1049853773 8:144849107-144849129 CTGCAGGAACAGCAGCTTTAGGG - Intronic
1050039436 9:1473659-1473681 CTCCAGCAAATGCAGGTGGAAGG - Intergenic
1051816096 9:21106800-21106822 ATTCAGGAACTGTACCTGGGAGG + Intergenic
1052935240 9:34087493-34087515 CCTCTGGAGCTGCACCTGGATGG + Exonic
1055618438 9:78097657-78097679 CTTGTGGAAATGCAGCTGTAAGG - Intergenic
1056541220 9:87572986-87573008 CTTCAGAATCAGCATCTGGAAGG - Intronic
1056722170 9:89081881-89081903 GGTCAGGAGCTGCAGCTGAAAGG - Intronic
1056974240 9:91236063-91236085 CATCAGGAAGTACAGATGGATGG + Intronic
1057207290 9:93181169-93181191 CTCCTGGAACTGCATCTGCATGG + Intergenic
1057423488 9:94930030-94930052 CTCCAGGACCTTCAGCAGGAAGG + Intronic
1057820581 9:98327385-98327407 ATTCAGGAAGTGCTGCTGGAGGG - Intronic
1057831404 9:98409841-98409863 TTTCAGGAACAGAAGCTGGAAGG - Intronic
1058572644 9:106364188-106364210 CTTCAGGAAAGGAAGCTAGAAGG - Intergenic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1060149783 9:121281288-121281310 CTGCAAGACCTGCTGCTGGAGGG - Intronic
1060861212 9:126956319-126956341 CCTCAGGGACTGAAGTTGGATGG + Intronic
1061084558 9:128391534-128391556 CTTCTAGAAGTGCAGCTGTAGGG - Exonic
1061120217 9:128637299-128637321 CCTCAGGGGCTGCAGCAGGAAGG + Intronic
1061238000 9:129353111-129353133 CTGCAGGGTCAGCAGCTGGAAGG + Intergenic
1061354880 9:130097078-130097100 CTTCTGGGACTGCAGCTCGGAGG - Intronic
1061972657 9:134053349-134053371 CTGCATGTACTGCAGCTGGTTGG + Exonic
1061990412 9:134155679-134155701 CTTCAGGCACTGAAACAGGAGGG - Exonic
1062291317 9:135796473-135796495 CTTCAGGAGCTGGAGCTGCGGGG - Intergenic
1062663720 9:137654947-137654969 ATTCAGGGACTGCAGCAGGAAGG + Intronic
1186276849 X:7948657-7948679 CTTCAGGGACTACAGCTGGCTGG - Intergenic
1186826928 X:13349693-13349715 CTTCAGGAGACGCAGATGGAAGG + Intergenic
1186887137 X:13925251-13925273 CTTCTGAAAGTCCAGCTGGATGG - Intronic
1189211851 X:39290483-39290505 GGTAAGGAAGTGCAGCTGGAGGG - Intergenic
1189409311 X:40755783-40755805 CTTCAGGATCTGCTGTGGGAAGG + Intergenic
1189869470 X:45367325-45367347 CTTCTGTAACTGCAACTGGTTGG - Intergenic
1190373119 X:49762235-49762257 CTTGGGGCACTGCAGATGGAAGG + Intergenic
1190623067 X:52307993-52308015 CTGAAGCAACTGCAGCTGGAGGG + Intergenic
1191963308 X:66727360-66727382 CTTCCAGATCTGAAGCTGGAAGG + Intergenic
1192529415 X:71872372-71872394 GCTCAGGAGCTGCCGCTGGAGGG - Intergenic
1193509761 X:82384458-82384480 CTTCAGGATCTGCTGAGGGAGGG + Intergenic
1194800255 X:98264225-98264247 GTGCAGCAACTGCAGCTGCAGGG - Intergenic
1195320077 X:103714559-103714581 TTCCAGGCATTGCAGCTGGATGG + Intronic
1195813872 X:108864062-108864084 CCTCAAGAACAGCAGCTAGATGG - Intergenic
1196727753 X:118912427-118912449 TTTCAGTAACTGCCTCTGGAGGG + Intergenic
1197612869 X:128658216-128658238 ATTCAGGGACTGTAGCTGCAGGG + Intergenic
1198106646 X:133468310-133468332 CTTCAGGACCAACAGCTGGTGGG - Intergenic
1200078681 X:153564940-153564962 CTTCAGGCACTTGAGCTGGCTGG - Exonic
1200104146 X:153703127-153703149 CTTGAGGAACCGCAGCTCGGTGG - Intronic