ID: 955953271

View in Genome Browser
Species Human (GRCh38)
Location 3:64263402-64263424
Sequence GTCCATGTGCCCCAAAGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955953268_955953271 17 Left 955953268 3:64263362-64263384 CCACAATTCTGCAGCAATTAAGC 0: 1
1: 0
2: 0
3: 16
4: 116
Right 955953271 3:64263402-64263424 GTCCATGTGCCCCAAAGACTAGG 0: 1
1: 0
2: 0
3: 14
4: 141
955953267_955953271 24 Left 955953267 3:64263355-64263377 CCTGTATCCACAATTCTGCAGCA 0: 1
1: 0
2: 0
3: 27
4: 406
Right 955953271 3:64263402-64263424 GTCCATGTGCCCCAAAGACTAGG 0: 1
1: 0
2: 0
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955953271 Original CRISPR GTCCATGTGCCCCAAAGACT AGG Intronic
903364429 1:22797300-22797322 GTCCATGTCTCCCACTGACTTGG - Intronic
904332521 1:29769831-29769853 GTCCATGTGAACCCAAGATTTGG + Intergenic
904356418 1:29942957-29942979 CTTGATGTGCCCCAAAGTCTTGG - Intergenic
906102113 1:43270484-43270506 GTCTATCTGCCCCAGAGCCTGGG - Intronic
906358636 1:45132476-45132498 GTCCCTGTGCCCTAAAAACAAGG + Intronic
907312236 1:53545277-53545299 GTCCATGGACCCCAAGGACAGGG + Intronic
907977360 1:59444842-59444864 GTCCTGGTGCCCAAAAGGCTGGG + Intronic
908034952 1:60041920-60041942 GTCACTATGCCCCAAAGCCTGGG + Intronic
910443783 1:87280136-87280158 GGCCTTGTGACCCATAGACTAGG + Intergenic
911933930 1:103942184-103942206 TTCCATGGGCACAAAAGACTTGG - Intergenic
913058468 1:115183427-115183449 GTCCCTGTGCTCCCAAGCCTGGG + Intergenic
915145626 1:153794429-153794451 GCCACTGTGCCCCAAAGCCTGGG - Intergenic
915294283 1:154909242-154909264 ATCCATGTGCCCCAGAGCCCAGG + Intergenic
915956399 1:160223951-160223973 TTCAATGTGCCCCAAAGTTTGGG + Intronic
919134919 1:193495845-193495867 TTCCAATTGTCCCAAAGACTAGG + Intergenic
919299091 1:195738383-195738405 GTCCATTTGTCCTAAAGAATTGG + Intergenic
919647750 1:200112762-200112784 GTACATTTTCTCCAAAGACTTGG - Intronic
923777903 1:236996308-236996330 GTCCATTGGCCCCAAAGATCAGG - Intergenic
1063054114 10:2484602-2484624 GGCCATGTGACCCCAAGACATGG + Intergenic
1063308492 10:4930376-4930398 GTCCATTTTCCCCAAGAACTGGG + Intronic
1063318182 10:5027106-5027128 GTCCATTTTCCCCAAGAACTGGG - Intronic
1064119866 10:12609284-12609306 GTCCTGGTGCCCAAAAGATTGGG - Intronic
1064563821 10:16619661-16619683 GTCCATGTGTCCATAAGTCTAGG - Intronic
1066083197 10:31952644-31952666 ATCCATTTCCCCCAAAGAATTGG - Intergenic
1067804494 10:49383533-49383555 GCCAATTTGGCCCAAAGACTTGG + Intronic
1072781318 10:98253669-98253691 GTCCATGTGATCCGCAGACTTGG + Exonic
1077490521 11:2858873-2858895 GTCCATGTGTCCCCATGCCTTGG - Intergenic
1081158572 11:39725479-39725501 GCCTATGTTCCTCAAAGACTTGG + Intergenic
1084474793 11:69382598-69382620 GTCCACTTGCCCCAAAGGCCAGG - Intergenic
1084616264 11:70238150-70238172 GTCCATGTGTCCCAAATCCATGG + Intergenic
1084894058 11:72252412-72252434 TTCCATGTGCCCACCAGACTGGG - Intergenic
1086944889 11:92835198-92835220 GTCCATTTGTCCCCAAGAATAGG + Intronic
1088651909 11:111965026-111965048 ATCCCTGAGCCCCTAAGACTGGG - Intronic
1088968877 11:114753973-114753995 GTCCATGTGCCACATTGACTGGG + Intergenic
1094078245 12:26502580-26502602 GTGCATGCTCACCAAAGACTGGG + Intronic
1100056780 12:90521545-90521567 ATTCATGTGCCCCAAAGACATGG + Intergenic
1101823558 12:108202880-108202902 GTCCATCTTCCCCAAAGCCTGGG - Intronic
1102498959 12:113338228-113338250 TTCCATGTCCCCCACAGGCTGGG + Intronic
1102590786 12:113955400-113955422 CTCCATGTGCCCCTGAGACGAGG + Intronic
1105476178 13:20729882-20729904 GTCCACGTGCCCCAAAACCTCGG + Intronic
1105899185 13:24741682-24741704 GTCCATGTACCCCAAATGCTGGG + Intergenic
1108465858 13:50714784-50714806 TTCTATGTTCCCCAAAGCCTAGG - Intronic
1109968453 13:69733694-69733716 CTCCATGTGCCCTACTGACTTGG - Intronic
1111572269 13:90104261-90104283 CACCATGGGGCCCAAAGACTGGG - Intergenic
1112386986 13:98949045-98949067 GGATATATGCCCCAAAGACTTGG - Intronic
1112809180 13:103197890-103197912 GTCCAAGTGCCCAGAAGAATGGG - Intergenic
1113735089 13:112672710-112672732 GTCCCAGTGCCCCACAGCCTGGG + Intronic
1114565284 14:23627319-23627341 GTCCATTCTCCCCAAAGAATTGG + Intergenic
1116170384 14:41393506-41393528 GTCCCTGGTGCCCAAAGACTGGG - Intergenic
1118439552 14:65800100-65800122 TTCCATGAGCCCCAAAACCTGGG + Intergenic
1119597039 14:75944552-75944574 ATCCATTTTCCCCAAAGAATTGG + Intronic
1121331559 14:93052821-93052843 TCCCAGATGCCCCAAAGACTTGG + Intronic
1121872090 14:97417604-97417626 GTTCATGTGCCGCATGGACTGGG + Intergenic
1123923800 15:25089332-25089354 GTACATGTCCCCCAAACACATGG - Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1131195868 15:90354378-90354400 GTCAATGTGTCTAAAAGACTGGG + Intronic
1132239909 15:100249533-100249555 GTCCATGTGCCACCACGGCTGGG - Intronic
1134348925 16:13418335-13418357 GTCCATGTTCCACAATGTCTAGG + Intergenic
1139117128 16:63969003-63969025 ATCCATGTGCCTCTAAGTCTGGG - Intergenic
1139285046 16:65805228-65805250 CTCCATCTGTCCCAGAGACTTGG - Intergenic
1142482866 17:229487-229509 CTCCATGTCCCCCAAAGAGCTGG + Intronic
1142593556 17:1018573-1018595 GTCCAGGTCCCCCTGAGACTTGG - Intronic
1142851672 17:2707570-2707592 GTCCAGGTACCCCAAATTCTGGG - Intronic
1144818046 17:18050471-18050493 GCCCATGGCCCCCAAAGGCTGGG - Intronic
1145766402 17:27460918-27460940 GTCCCTAGACCCCAAAGACTGGG - Intronic
1147215768 17:38898198-38898220 TTCACTGTGCACCAAAGACTTGG + Intronic
1149355627 17:55836400-55836422 TACCAAGTGCCCCAAAGACAAGG + Intronic
1153656697 18:7289126-7289148 GTCCTCGGGCCCCAGAGACTGGG + Intergenic
1155950431 18:31905379-31905401 GTCCATATGCACCAAAGTGTAGG - Intronic
1160530075 18:79557478-79557500 GTCCATGGGCCCCCAAAACCAGG + Intergenic
1163572646 19:18091345-18091367 TTTCAGGTGCCCCACAGACTCGG + Intronic
1163595873 19:18220781-18220803 GTCCATGAGCCCCTTATACTGGG - Intronic
1168374769 19:55867541-55867563 GTCTCTGTACCCCAGAGACTGGG + Intronic
925064066 2:915325-915347 GTCCACGCCCCCCAATGACTGGG + Intergenic
927143923 2:20148414-20148436 TTCCCTGTTCCCCAAAGGCTTGG + Intergenic
929582101 2:43087914-43087936 GCCCATGTCCCCCAAGGAATAGG - Intergenic
935303623 2:101716078-101716100 GTCCCTGTGCCAAAAAGATTGGG + Intronic
935556195 2:104512085-104512107 GTCAATGTGTCCCAAAGTCGTGG - Intergenic
937980184 2:127610075-127610097 GTCCAGCTGCCCCAGGGACTGGG - Intronic
938158212 2:128959297-128959319 GTCCATGTTTGCCCAAGACTAGG - Intergenic
940179589 2:150917381-150917403 GGTCATATGCCCCTAAGACTAGG - Intergenic
940409740 2:153347366-153347388 TGGCATGTGCACCAAAGACTTGG - Intergenic
942403177 2:175624896-175624918 CTCCATGTGCCTCAGAAACTAGG + Intergenic
946684780 2:222256532-222256554 GTCCCTCGGCCCCAGAGACTCGG + Intronic
947767720 2:232648222-232648244 CTCCTTGTGCCCCAAACACTCGG - Intronic
1170674646 20:18467608-18467630 GTCCAGCTGCCCAAATGACTGGG - Intronic
1173493641 20:43503430-43503452 GTCCATGTGGCCCTGAGAGTTGG - Intergenic
1175426902 20:58873480-58873502 GTCCCTGTGTACCAAGGACTGGG - Intronic
1176295525 21:5070100-5070122 GTCCTGGTGCCCAAAAGGCTGGG - Intergenic
1179861525 21:44192024-44192046 GTCCTGGTGCCCAAAAGGCTGGG + Intergenic
1181552722 22:23649890-23649912 GGCCATGTGAACCAAGGACTAGG + Intergenic
1183142417 22:35955494-35955516 GTCCCTGTGCCAAAAAGATTGGG - Intronic
949752465 3:7370307-7370329 ATCCATGTACCCCACAGGCTTGG + Intronic
950137323 3:10590798-10590820 GTGCATGTGCCTTCAAGACTTGG + Intronic
953671406 3:44965341-44965363 CTCCATGAGCCCCAGGGACTGGG + Intronic
954001187 3:47558409-47558431 GTCCAAGTGGCCCAAACGCTGGG - Intergenic
955953271 3:64263402-64263424 GTCCATGTGCCCCAAAGACTAGG + Intronic
957039815 3:75328323-75328345 GGGCATGTGCCACAAAGACCAGG + Intergenic
959126809 3:102299892-102299914 GTCCAGGTCCTCCTAAGACTGGG - Intronic
964021938 3:152023017-152023039 GTGTATGTGCCACATAGACTTGG - Intergenic
964038641 3:152230860-152230882 GTATATGTGCCGCATAGACTTGG - Intergenic
964776237 3:160281373-160281395 GTCCATTTTCCCCATAGAATTGG + Intronic
971593958 4:28503738-28503760 GTCTATGTGCCCAAAAGACAAGG + Intergenic
972024294 4:34357914-34357936 GACCATTTTCCCCAAAGAATTGG - Intergenic
972987062 4:44777707-44777729 ATCCATTTTCCCCAAAGAATTGG + Intergenic
979992384 4:127390422-127390444 ATACATGTGCCCCAGAGCCTAGG + Intergenic
981525735 4:145705489-145705511 ATCCATTTTCCCCAAAGAATTGG - Intronic
983658417 4:170106995-170107017 ATCCATTTTCCCCAAAGAATTGG + Intergenic
984375337 4:178922354-178922376 GTCCATGGGCAGCCAAGACTGGG - Intergenic
985022308 4:185704782-185704804 GTTCATTTGCCCAAGAGACTTGG + Intronic
986005098 5:3660843-3660865 GCCCAGGTGCCCGAAAGCCTGGG - Intergenic
986651356 5:9966427-9966449 ATTCATGGGCTCCAAAGACTCGG - Intergenic
988125069 5:27021696-27021718 CTTCATGTTCCCCATAGACTGGG + Intronic
988246700 5:28692994-28693016 GTCTAGGTGGCCCAAATACTTGG + Intergenic
989387196 5:40865768-40865790 GTCCATGAGGCCTAAAGACATGG - Intergenic
995590595 5:113695840-113695862 GTCCTTGTTTCCCAATGACTTGG + Intergenic
997642548 5:135458839-135458861 GTCCAGGAGCCCCAAAACCTAGG - Intergenic
997667969 5:135647636-135647658 GTCCATGTGTCCCAGAGCCCAGG - Intergenic
999667898 5:153932990-153933012 TTCCATGTTCCCCAAAGAAAGGG - Intergenic
999702367 5:154239609-154239631 GTCCCTGTGCCAAAAAGATTGGG + Intronic
1000771984 5:165366048-165366070 GACCATGTGCCCCAGAGAAAAGG + Intergenic
1001570221 5:172725905-172725927 GTCCCAGGGCCCCAAAGACAGGG + Intergenic
1001600051 5:172922858-172922880 TTCCATGTTCCCCACAGCCTGGG - Intronic
1001863367 5:175080453-175080475 GTCCATCTGCCCCATAGAGTAGG - Intergenic
1002294350 5:178221943-178221965 GACCCTGTACCCCAAAGACAGGG + Intronic
1002297322 5:178238899-178238921 GTCCATGTGACCCACAGGATGGG + Intronic
1003164463 6:3664012-3664034 CTCCATGCGCCTCACAGACTGGG + Intergenic
1003609322 6:7594927-7594949 GTCCACGTGCCCAAAGGGCTTGG + Intronic
1006389375 6:33749544-33749566 GGCCATCTGCCCCACTGACTAGG - Intergenic
1007203726 6:40132366-40132388 GTCCAGGTTCCACAAATACTTGG + Intergenic
1007247586 6:40473443-40473465 GACCATTTCCCCCAATGACTGGG - Intronic
1007607151 6:43125297-43125319 CCCCCTGTGCCCCAACGACTGGG - Intronic
1008136741 6:47785946-47785968 GTCCATGTCTCCCAAAGAGGCGG + Intronic
1011321072 6:86094463-86094485 GGCCATGTCCCCCAAAGACAAGG - Intergenic
1017246081 6:152226768-152226790 GTCCATAGGCTCCAAAGACTGGG - Intronic
1019633239 7:2061408-2061430 GTCCAGGTGCCCCCAGGAGTCGG + Intronic
1019887569 7:3918694-3918716 GTCCCTGTGCCAAAAAGGCTGGG + Intronic
1024912941 7:54466803-54466825 ATCCATGGGCCCCAGAGACTGGG - Intergenic
1029924835 7:104304512-104304534 GTCCATGTGCAAAAAAGACTTGG + Intergenic
1030128622 7:106178453-106178475 GACTATGTTCCCCAAAGCCTTGG + Intergenic
1033499736 7:141935933-141935955 TTCAGTCTGCCCCAAAGACTGGG - Exonic
1033701843 7:143845611-143845633 GTCCATATCTCCCCAAGACTTGG - Intergenic
1034169774 7:149054101-149054123 GTCCCTCTGCCCCACATACTGGG + Intergenic
1035634371 8:1132815-1132837 ATCCATGAGCCCCAGCGACTGGG - Intergenic
1039010752 8:33090280-33090302 CTGCATGTGCACCACAGACTGGG + Intergenic
1039434979 8:37553776-37553798 GTCAATGTGCCCCAATGACAGGG + Intergenic
1040299581 8:46180935-46180957 GGCCATCTGCTCCAAAGCCTGGG + Intergenic
1040334707 8:46410124-46410146 GTCACCGTGCCCCAAAGGCTGGG - Intergenic
1041140043 8:54808025-54808047 GGCCATGGGGCCCAAATACTTGG - Intergenic
1043013644 8:74910993-74911015 GTCCCTGTGCCAAAAAGGCTTGG + Intergenic
1045956725 8:107916804-107916826 GTCCATGTGCCCAAATAACATGG + Intronic
1047182709 8:122604766-122604788 GTGTATGTGACCCAAAGACTTGG + Intergenic
1194215385 X:91124379-91124401 ATCCATTTTCCCCAAAGAATTGG + Intergenic
1194850673 X:98864881-98864903 GCCCATTTTCCCCAAAGAATTGG + Intergenic
1196626685 X:117885071-117885093 GTCCATGTGCCCTCTAGACAGGG - Intergenic
1202091078 Y:21191196-21191218 GTAGATGTGGCCTAAAGACTGGG + Intergenic