ID: 955955075

View in Genome Browser
Species Human (GRCh38)
Location 3:64280444-64280466
Sequence CCTGCCAGGCGCTTCAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955955075_955955079 -3 Left 955955075 3:64280444-64280466 CCCTCATTGAAGCGCCTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 955955079 3:64280464-64280486 AGGCACTGTTCTAAGTGTTGAGG 0: 3
1: 18
2: 113
3: 481
4: 1497
955955075_955955080 3 Left 955955075 3:64280444-64280466 CCCTCATTGAAGCGCCTGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 955955080 3:64280470-64280492 TGTTCTAAGTGTTGAGGATGTGG 0: 1
1: 0
2: 2
3: 36
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955955075 Original CRISPR CCTGCCAGGCGCTTCAATGA GGG (reversed) Intronic
903891884 1:26575191-26575213 CCTGCCAGGGGATTCCATTATGG + Intergenic
910132252 1:83922120-83922142 CCTGCTAGGTCTTTCAATGATGG - Intronic
917300360 1:173567746-173567768 CCTTCCAGCCCTTTCAATGAAGG + Intronic
924470752 1:244340620-244340642 CCTGCCAGCCGCCTCACTAACGG + Intergenic
1071085363 10:81862942-81862964 CCTGCCAGCCGGGGCAATGAGGG - Intergenic
1083307532 11:61769082-61769104 CCTGCCAGGCACCCCAATGTGGG + Intronic
1084421874 11:69064318-69064340 CCCGCCAGGCTATTCACTGAGGG + Intronic
1088817004 11:113428313-113428335 CCTGCCAGTTGCCTAAATGAGGG + Intronic
1089893006 11:121900009-121900031 CCTGCCCTGCACTTGAATGATGG - Intergenic
1091565366 12:1644210-1644232 CCTGACAGACACTTCAAAGATGG - Intronic
1094327553 12:29256750-29256772 CCTGCCAGCCCCGGCAATGAAGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104058356 12:125247435-125247457 CCTGGCAGGGGCATCAAAGATGG - Intronic
1105241372 13:18611790-18611812 CCTGCCTTGCCCCTCAATGATGG + Intergenic
1106136642 13:26978553-26978575 CCTGACAGACTCTTCATTGAAGG + Intergenic
1106999484 13:35526871-35526893 ACTGCAAGTGGCTTCAATGATGG + Intronic
1110620120 13:77585669-77585691 CCTGACTGGGGTTTCAATGAGGG - Intronic
1112239369 13:97665772-97665794 CCTGCTAGAAGCTTCAATGATGG + Intergenic
1113465669 13:110511173-110511195 CCTGCCGTGCGCTTCCATAAAGG + Intronic
1116467704 14:45253034-45253056 CCTGCCAGGCTCTTCATCCAAGG - Exonic
1202858140 14_GL000225v1_random:64093-64115 CCTGCCAGGCCCTTGAGTGGTGG - Intergenic
1123791729 15:23727957-23727979 CCTGCCAGGCAGTTCCTTGATGG - Intergenic
1129019613 15:72504425-72504447 CCTGCCAGACGCTTGAAGGATGG + Intronic
1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG + Intronic
1137057440 16:35752384-35752406 CTTGCCAGGGGCTTCACTGGGGG + Intergenic
1137630865 16:49943450-49943472 CTTACCAGGGGCTTGAATGAGGG + Intergenic
1145907241 17:28523272-28523294 CTTGCCAGGCGCTGCAGTGTGGG + Intronic
1149785876 17:59434471-59434493 CCTGCCAGGTGTTACAAGGAGGG + Intergenic
1151721866 17:75861489-75861511 CCTGCCAGGCTCTGCCAAGAGGG - Intergenic
1153001521 18:459679-459701 CCTTCCAGAAGCTTCAATGGTGG + Intronic
1153915703 18:9742321-9742343 CCTGCCAGGAACTTCCCTGAAGG - Intronic
1154151320 18:11908628-11908650 CCTGCCAGGCACTTCGCGGAGGG - Exonic
1156377515 18:36528115-36528137 CATGGCAGGCCCTTCAATAAAGG + Intronic
1165470001 19:35997717-35997739 CCTGCCAGGAGCTCCAATCCTGG - Intergenic
1167529894 19:50008673-50008695 ACTGACATGCGCTCCAATGAAGG + Intronic
1168669115 19:58228115-58228137 CCGTCCTGGCTCTTCAATGAGGG - Intergenic
926615719 2:14994927-14994949 CCAGCCATGGGCTTCAAGGATGG - Intergenic
927915582 2:26934045-26934067 CCTCCAAGGGGCTTCAGTGAGGG - Intronic
934234337 2:90216946-90216968 CCTGGCAGGGGCTTCAGGGAAGG - Intergenic
937545581 2:123014618-123014640 GTTGCCAGGGGCTTCAAGGAGGG + Intergenic
948076168 2:235166848-235166870 CCTGCCAGGGGTTACAAAGACGG - Intergenic
948899671 2:240949927-240949949 CCTTCCAGCCTCTTCCATGAGGG - Intronic
1173630318 20:44508654-44508676 CATGCCAGGAGCTTGAATGCAGG + Intronic
1181512433 22:23394900-23394922 CCTGCCAGGAGCTGCAGAGAAGG + Intergenic
1184033723 22:41909076-41909098 CCTCCCAGGAGCTTCTCTGAAGG - Intergenic
1184258492 22:43301109-43301131 CCTGCTAAGGGCTTCAATGTGGG - Intronic
953575669 3:44111347-44111369 CCTGCCAGGCGACTCCACGATGG + Intergenic
955955075 3:64280444-64280466 CCTGCCAGGCGCTTCAATGAGGG - Intronic
967166423 3:186783769-186783791 CCTTCCAGAAGCTTCCATGATGG + Intronic
967168689 3:186806747-186806769 CCTGGCAGGCTCAGCAATGAGGG + Intronic
984451701 4:179911460-179911482 CCTGCCAGGCACTTCCATCGTGG - Intergenic
984916307 4:184727965-184727987 GCTGCCAGGGGCTTGAAGGAAGG + Intronic
985710658 5:1426768-1426790 GCTGCCAGGGGCTGCAGTGAGGG + Intronic
993232220 5:85250060-85250082 CCTGCCTGGGGCAACAATGATGG - Intergenic
999624353 5:153504744-153504766 CCTCCCAGTCGCTTCTATGTGGG - Intronic
1008182688 6:48352518-48352540 CCAGCCAGGTTCTTCACTGAAGG - Intergenic
1012264801 6:97128792-97128814 CCTGGCAGGCACTGCAGTGAAGG + Intronic
1012280517 6:97322442-97322464 CCTGCCTGGTGCTTCTCTGATGG + Intergenic
1015002376 6:128233909-128233931 CCTGCCAAGCGCTGTAATGATGG + Intronic
1017306188 6:152921490-152921512 CCTGCTAGGCCCTTGACTGATGG - Intergenic
1035655947 8:1305025-1305047 CCTGCCAGCCACTGCAATGGTGG - Intergenic
1038149257 8:24927939-24927961 CCTGGCACGCGCTTCAATCTCGG + Intergenic
1045240636 8:100397832-100397854 CCTGCCAGACGCTCAAATAAAGG + Intronic
1053097607 9:35342043-35342065 CCTGCCAAGCCCTTCACTGAGGG + Intronic
1055048482 9:71955408-71955430 GCTGCCATGTGCTTCAATAACGG + Intronic
1062085616 9:134646522-134646544 CCTGCCAAGCCCGTGAATGAGGG - Intronic
1185831682 X:3309465-3309487 CATGCCAGGGGCTTCATTCAGGG - Exonic
1190568028 X:51751030-51751052 CCTGTCAGTAGCTACAATGAAGG + Intergenic
1191715510 X:64191284-64191306 GCTGCCAGGCCCATCACTGATGG + Exonic
1196795151 X:119496215-119496237 CCGGCCAGGGGCTCCTATGAGGG + Intergenic
1198300380 X:135328546-135328568 CTTGCCAGGCACTTCTCTGAGGG - Intronic
1201244317 Y:11987614-11987636 CATGCCAGGGGCTTCATTCAGGG + Intergenic