ID: 955957136

View in Genome Browser
Species Human (GRCh38)
Location 3:64302552-64302574
Sequence TGGCAACTAGAATCACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955957136 Original CRISPR TGGCAACTAGAATCACAAAG AGG Intronic
911623717 1:100096811-100096833 TGCAAACTAAAATCACAATGAGG + Intronic
912201929 1:107468140-107468162 TAGCTACTAAAATCACACAGCGG - Intronic
914050709 1:144127907-144127929 AGGGGACAAGAATCACAAAGTGG - Intergenic
914128473 1:144837537-144837559 AGGGGACAAGAATCACAAAGTGG + Intergenic
917241699 1:172955736-172955758 TGGCAACAAGGATAACTAAGAGG + Intergenic
917802022 1:178580231-178580253 TGGTCACTAGAATCACAGCGAGG - Intergenic
920270326 1:204758105-204758127 TGGGAACTAAAAACACCAAGGGG - Intergenic
921015062 1:211182184-211182206 TGGAAACTTGAATCACTAAGGGG - Intergenic
922144820 1:222931472-222931494 TCTCAACTAAAATCACAAAATGG - Intronic
922535196 1:226374583-226374605 TGGCAACTAGAATAAGAATCTGG - Intronic
924087065 1:240463513-240463535 TGGTAGTTAGAATTACAAAGTGG + Intronic
1063338806 10:5243819-5243841 TAGAAACTGGACTCACAAAGAGG - Intergenic
1068158796 10:53236927-53236949 TGGCAATAAGAATGACTAAGAGG + Intergenic
1068590268 10:58846010-58846032 TGGAAACAAGAAGCAGAAAGAGG + Intergenic
1070748422 10:78949139-78949161 TGTTAAAGAGAATCACAAAGTGG - Intergenic
1072875449 10:99168617-99168639 TTGCAGGTAGACTCACAAAGGGG + Intronic
1074039172 10:109771076-109771098 TGGAAAATAGATTCACATAGGGG + Intergenic
1076503194 10:130953089-130953111 TGGTAACTAGCATCAAAGAGTGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1080321995 11:31020858-31020880 TTGTAACTCAAATCACAAAGGGG + Intronic
1080829188 11:35875642-35875664 TGGCAGCTGGAATAACAAAGTGG - Intergenic
1082733047 11:56824092-56824114 TGGCAAGGAGAATCCTAAAGGGG - Intergenic
1085413595 11:76306151-76306173 TGGCAGCCAGGATCCCAAAGTGG + Intergenic
1085440089 11:76553330-76553352 TGGAAATTAGAACCACAATGGGG - Intergenic
1086263282 11:84967035-84967057 AGGCAACTAGAATTACACATTGG + Intronic
1089005979 11:115091146-115091168 TGGCAACTGCAAACACCAAGAGG + Intergenic
1090641195 11:128730258-128730280 TGAAAACTGGAATCTCAAAGAGG + Intronic
1092644687 12:10557543-10557565 TGGGATTGAGAATCACAAAGGGG + Intergenic
1095297648 12:40545328-40545350 TGGAACCTGGAATCACTAAGAGG - Exonic
1097920683 12:65069208-65069230 TGGAAAGAAGAATCATAAAGTGG + Intronic
1098856901 12:75663281-75663303 TGGCATCAAGACCCACAAAGTGG + Intergenic
1101499840 12:105292934-105292956 TGCCAACTAGAACTCCAAAGTGG - Intronic
1105752351 13:23433254-23433276 TGGAAATTAAAATGACAAAGCGG + Intronic
1105856902 13:24382443-24382465 AGGCAACTAGAAACGGAAAGGGG + Intergenic
1109966818 13:69710774-69710796 TGGCAACTAGAGGCAAAAAATGG - Intronic
1110366879 13:74696629-74696651 TGACATCTAGAATCAGAAATGGG - Intergenic
1111049268 13:82857880-82857902 TAGAAACTAGAATGAAAAAGAGG - Intergenic
1111091981 13:83459159-83459181 TGCAAGCTATAATCACAAAGAGG - Intergenic
1111386370 13:87533953-87533975 TGGAAAATAGATCCACAAAGTGG + Intergenic
1111977440 13:94981344-94981366 TGTGAACCAGAATCACACAGAGG - Intergenic
1121911738 14:97797986-97798008 TGGCAAGCAAAAACACAAAGGGG + Intergenic
1122904714 14:104796303-104796325 TGGCAGCTACACTCACAAAAGGG + Intergenic
1126875120 15:53033059-53033081 TGGCAAATAGCATCAGCAAGTGG + Intergenic
1130240972 15:82190665-82190687 TGGCAAGTAGAATCACAATAAGG + Intronic
1130459453 15:84150467-84150489 TGGCAAGTAGAATCATAATAAGG - Intergenic
1134333955 16:13277181-13277203 AAGCAAATAGAATCATAAAGTGG - Intergenic
1140318302 16:73921388-73921410 TAGCCCCTGGAATCACAAAGCGG + Intergenic
1142131031 16:88431556-88431578 TGGCAACTGGAACCCCCAAGGGG - Exonic
1143787398 17:9266173-9266195 TGACAACTGGAAACACAGAGGGG + Intronic
1145767600 17:27469760-27469782 TGGCAACTAAAATGACCAAAAGG - Intronic
1148653781 17:49268264-49268286 TGGAAACTTGGATCACAAAAAGG + Intergenic
1148960974 17:51392536-51392558 TGGCAACCACCATCACAAGGTGG + Intergenic
1149063619 17:52454177-52454199 TGACAACTAGAATCACAGCAAGG - Intergenic
1150103618 17:62445314-62445336 TGGCCACTATAATCAAAAAATGG + Intronic
1150126016 17:62635512-62635534 AGGCAACTAGAGGCAAAAAGGGG - Intronic
1151873896 17:76855401-76855423 TTGCAACTAGAGTCTCAAAGAGG - Intergenic
1152215757 17:79031400-79031422 TGGAAACTAGAAAAACAAGGTGG - Intronic
1155327471 18:24679370-24679392 TGGCAACAAGAATGAGAAAGAGG - Intergenic
1156392823 18:36666899-36666921 GGGCAGCAATAATCACAAAGAGG - Intronic
1157162623 18:45328054-45328076 TGGCAACTGAAAAAACAAAGTGG + Intronic
1159399246 18:67908880-67908902 TGGCAACCTGAAACACAAATAGG + Intergenic
1202690116 1_KI270712v1_random:80546-80568 AGGGGACAAGAATCACAAAGTGG - Intergenic
925418295 2:3689188-3689210 TGGCAACTAAAATAATACAGAGG - Intronic
925868924 2:8252718-8252740 TGGCATCCAGCATCATAAAGTGG - Intergenic
927268323 2:21178323-21178345 GGGCAAATAGAAAAACAAAGAGG + Intergenic
928196172 2:29218233-29218255 TGGCAACGAGAGCCACACAGAGG + Intronic
928854457 2:35788100-35788122 TGACAATTGGAATCACAAACAGG + Intergenic
929539768 2:42810652-42810674 TGGCAACGAGATACACAAAAGGG - Intergenic
932953255 2:76318458-76318480 TGGCACAAAGAATCACATAGTGG - Intergenic
932959005 2:76390146-76390168 TGGGAACTGGAATCACATGGAGG + Intergenic
932959336 2:76394448-76394470 TGGAAAGTAGAATCAGAACGAGG - Intergenic
933351891 2:81163551-81163573 CAGCAACTAGAAACACAAAGAGG + Intergenic
933956297 2:87375471-87375493 AGGGGACAAGAATCACAAAGTGG + Intergenic
934240447 2:90267495-90267517 AGGGGACAAGAATCACAAAGTGG + Intergenic
934272743 2:91549252-91549274 AGGGGACAAGAATCACAAAGTGG - Intergenic
936930851 2:117787242-117787264 TTGTAATTATAATCACAAAGAGG - Intergenic
938202937 2:129391479-129391501 TGGCCACTGAAAACACAAAGGGG + Intergenic
938263590 2:129911420-129911442 TGGCAACTGGAATCAGAACAGGG + Intergenic
939335834 2:140826803-140826825 GGGCAGCTAGAGACACAAAGGGG + Intronic
939564009 2:143765382-143765404 TGGCAAATGAAATAACAAAGTGG + Intronic
940671865 2:156679805-156679827 TGCAAACTAAAATCACAATGAGG - Intergenic
940677769 2:156746234-156746256 TGGCAACTAAAACCCCAAACAGG + Intergenic
940679701 2:156770732-156770754 TAGCAACTAGAATCAACATGAGG + Intergenic
941554845 2:166964814-166964836 GGGCAACTAGAAGAAAAAAGAGG - Intronic
941609134 2:167638852-167638874 TTGCAACTAGAATCCCAGATTGG - Intergenic
946059695 2:216931324-216931346 TGGCAACTAGAGTCACTCATTGG + Intergenic
946277529 2:218642716-218642738 TAGCCACTATAGTCACAAAGTGG + Exonic
1173363717 20:42366738-42366760 TAGCCACTAGAATCACAAGAGGG - Intronic
1173831029 20:46088951-46088973 CGGCAACTTCAATCACAAACCGG - Intronic
1173924508 20:46770820-46770842 TGGCAAGTAGAATGACAAGAAGG + Intergenic
1175012675 20:55755386-55755408 TGACAATCAGAATCACAATGAGG + Intergenic
1176981165 21:15382622-15382644 TGGCACCAAGAGTCACAAAATGG + Intergenic
1177877426 21:26650983-26651005 TGGCAAGTAGAATCTCAAGAAGG + Intergenic
1178825271 21:36010213-36010235 TGACATCTAGAAGCACAATGTGG + Intergenic
1178973294 21:37200303-37200325 TGGGCACAAGTATCACAAAGGGG + Exonic
949609480 3:5689495-5689517 TGGCAACTAGGATAATTAAGTGG - Intergenic
955714931 3:61819521-61819543 TGGCCACTAGCATCACAAATGGG + Intronic
955957136 3:64302552-64302574 TGGCAACTAGAATCACAAAGAGG + Intronic
956546664 3:70410618-70410640 TGGCAATGAGAATTATAAAGTGG + Intergenic
961629087 3:128283159-128283181 TGGCACCTGGAAACACACAGAGG + Intronic
964085342 3:152811053-152811075 TTATAACTAGAAGCACAAAGTGG + Intergenic
964096951 3:152942876-152942898 TGGGAATTAGAATCAGACAGAGG - Intergenic
966113038 3:176426797-176426819 TGGCAATTAGATTCACATTGAGG - Intergenic
966125416 3:176570745-176570767 TGGAAACTAAAATCAAGAAGGGG - Intergenic
966386083 3:179399600-179399622 TGACAATTAGAATAATAAAGTGG - Exonic
967109484 3:186281058-186281080 TGGAAGCTATAATCACAAAGAGG - Intronic
967468829 3:189839344-189839366 TTGCAGTTAGAAGCACAAAGTGG + Intronic
970228861 4:13888497-13888519 TGGCTACTATCATCACAAAAAGG - Intergenic
972916359 4:43884680-43884702 TAGAAATTAGAATCACAGAGAGG - Intergenic
974077915 4:57184525-57184547 AGGCAGCTAGAATCACAGAGTGG + Intergenic
975261519 4:72306382-72306404 AGAAAACTAGAATCACACAGAGG - Intronic
976495513 4:85725430-85725452 TTGCCACTAGAGTGACAAAGAGG - Intronic
977254539 4:94726258-94726280 TGGCAACTAATACCACAAATAGG - Intergenic
977797970 4:101191544-101191566 TGGCCACTAAAATCACAAGTGGG + Intronic
980329728 4:131395045-131395067 TAGCAATTAGAATTAGAAAGGGG + Intergenic
980493358 4:133559797-133559819 TTGCAACTAGAATCAGTAATGGG + Intergenic
985081656 4:186271412-186271434 TGGAAACGAAAATCACAAAATGG - Intronic
986350402 5:6872836-6872858 TGGGAACATGAAACACAAAGAGG + Intergenic
986707152 5:10461657-10461679 TTGCAACTAGCATCAGAAATGGG - Intronic
990283522 5:54276855-54276877 TAGCTGCTAGAAGCACAAAGGGG + Intronic
993582977 5:89686215-89686237 TGACAACTAGAACCACTAACTGG + Intergenic
994216269 5:97141614-97141636 ACACAACTAGATTCACAAAGAGG + Intronic
994787761 5:104186523-104186545 TGACAATTAGCATCACAAACAGG + Intergenic
996522909 5:124447367-124447389 TGGGAAATAAAATCACATAGAGG + Intergenic
997220509 5:132158419-132158441 TGGCATTTAGAATGAGAAAGTGG - Intergenic
997803140 5:136887229-136887251 TGGCAACTCAAATGACACAGAGG + Intergenic
998375865 5:141690191-141690213 TGGCAACTAGAAACTCGAATTGG + Intergenic
1000736930 5:164915126-164915148 TGACAACTAGATTCACCAACAGG - Intergenic
1004939747 6:20543379-20543401 TGGAAACTAAAACCACAATGAGG - Intronic
1005030652 6:21505688-21505710 TGTCCACTAGAATCACATGGAGG + Intergenic
1012042047 6:94218745-94218767 TGGCAAAGAGAATCACATATGGG + Intergenic
1016377829 6:143441828-143441850 TGTCAACTAAAACCACAATGAGG + Intronic
1020145967 7:5643363-5643385 TGGCAACTAGATTCTCAACCAGG + Intronic
1020496080 7:8854738-8854760 TGGCAACTTACAGCACAAAGTGG + Intergenic
1024219501 7:47276873-47276895 TGGCAAGGAGCAGCACAAAGAGG + Exonic
1028291599 7:89072358-89072380 TGGCAAGTAGAAACCAAAAGAGG - Intronic
1029654477 7:101915124-101915146 TGGCAACTAAAGACACACAGCGG - Intronic
1030157410 7:106468983-106469005 TGGGAAATAGAATCAGAAAAGGG - Intergenic
1030168958 7:106582478-106582500 TAGCAACTAGGAGCACAATGTGG + Intergenic
1030259261 7:107544733-107544755 AGGCAACAAGAATCACAATCAGG + Intronic
1030349251 7:108464806-108464828 TGGTAAGTAGAATCACAACTGGG - Intergenic
1031444450 7:121833790-121833812 AGGCAGCTAGCATCACAAAAGGG + Intergenic
1032032806 7:128498514-128498536 TGGCCACTATAATCAAAAAATGG + Intronic
1032255852 7:130296581-130296603 TGGCTACAGCAATCACAAAGAGG - Intronic
1036629105 8:10497817-10497839 TGGCAAGTAGAAGCAGAGAGAGG + Intergenic
1037639111 8:20726679-20726701 GGGCAAATACAATCACGAAGTGG - Intergenic
1040677176 8:49764549-49764571 TGTGAACTGGAATCACAAAAAGG + Intergenic
1050869440 9:10548597-10548619 TGGCTCCTGGAATCACACAGAGG + Intronic
1051628735 9:19123642-19123664 CTGCAACTAGAATCACAAATGGG + Exonic
1056074962 9:83029070-83029092 TGGTAACAAGCATCACAAACTGG - Intronic
1057180325 9:93026358-93026380 TGGTAACTTCATTCACAAAGGGG + Intronic
1057681484 9:97190480-97190502 TGGCAATAAGAATCATAAAATGG - Intergenic
1059185362 9:112264480-112264502 TGGCAAGTACAATCATAAACTGG + Intronic
1060241450 9:121907187-121907209 TGGGAACTAGAGACACAAATTGG + Intronic
1187247109 X:17562566-17562588 TGGCTGCTATAATCACAAAGGGG + Intronic
1187663659 X:21578771-21578793 AGGGAACTAGAATCTCTAAGTGG + Intronic
1189141041 X:38606370-38606392 TGGAGACTAGAGTTACAAAGAGG + Intronic
1189186954 X:39063061-39063083 GGGCTCCTAGAATCAGAAAGGGG - Intergenic
1190003949 X:46716813-46716835 AGGGAACTAGAATCAGAAACAGG - Intronic
1190581916 X:51898141-51898163 TGACACCCAGAATCACCAAGAGG - Exonic
1193212655 X:78825931-78825953 TGGTATAAAGAATCACAAAGTGG + Intergenic
1193730672 X:85099028-85099050 TGACAGCTAGACTGACAAAGAGG + Intronic
1198651088 X:138864527-138864549 TGGGAACGAGAAGCAAAAAGGGG + Intronic
1199232468 X:145453113-145453135 GGGCAACTATAAACCCAAAGAGG + Intergenic
1199334363 X:146600871-146600893 TGGCAACTAGAACCTGAAAACGG + Intergenic
1199772913 X:150985258-150985280 TGGAAACTACAATCACAAAGTGG - Intronic
1199943083 X:152642862-152642884 TGACAACTACTAGCACAAAGGGG + Intronic
1200276317 X:154736365-154736387 TGGCTGCTACAATCACAAAAAGG + Intronic
1202379607 Y:24263661-24263683 TGGCAAGTAGAATCACAATAAGG + Intergenic
1202491175 Y:25406460-25406482 TGGCAAGTAGAATCACAATAAGG - Intergenic