ID: 955962496

View in Genome Browser
Species Human (GRCh38)
Location 3:64355238-64355260
Sequence AGCCTGCCTAGTTACAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955962492_955962496 -2 Left 955962492 3:64355217-64355239 CCCTTGAGAACTGACGGACGAAG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 955962496 3:64355238-64355260 AGCCTGCCTAGTTACAAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
955962493_955962496 -3 Left 955962493 3:64355218-64355240 CCTTGAGAACTGACGGACGAAGC 0: 1
1: 0
2: 0
3: 4
4: 41
Right 955962496 3:64355238-64355260 AGCCTGCCTAGTTACAAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
955962491_955962496 1 Left 955962491 3:64355214-64355236 CCACCCTTGAGAACTGACGGACG 0: 1
1: 0
2: 0
3: 0
4: 43
Right 955962496 3:64355238-64355260 AGCCTGCCTAGTTACAAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101
955962489_955962496 18 Left 955962489 3:64355197-64355219 CCAGTAACTTCAGTTATCCACCC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 955962496 3:64355238-64355260 AGCCTGCCTAGTTACAAGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955962496 Original CRISPR AGCCTGCCTAGTTACAAGGG AGG Intronic
902234573 1:15049188-15049210 AGCCTCCCTAGTCACATGTGGGG + Intronic
902995281 1:20220126-20220148 AGCCTGTCAAATTACAAGGAAGG - Intergenic
903665445 1:25004464-25004486 AGCCTGCCCAGATTCATGGGAGG - Intergenic
904041040 1:27585312-27585334 AGCCTTCCAAGTTCAAAGGGCGG + Intronic
911636911 1:100246134-100246156 TGCCTGCCCAGTTACTTGGGAGG + Intronic
912855547 1:113165918-113165940 AGCCTGCCGTGTGACAAGGGAGG - Intergenic
914177328 1:145289662-145289684 AGTGTGTCTAGTTAAAAGGGAGG + Intergenic
916383058 1:164234675-164234697 ACCATGCCTAGCTGCAAGGGAGG + Intergenic
918711484 1:187736652-187736674 AGCCTGCAAAGTCACAGGGGTGG - Intergenic
1065601496 10:27373546-27373568 AGTGTGCTTTGTTACAAGGGTGG + Intergenic
1066367957 10:34794977-34794999 AGCCTGCCTAGGTTCAGGGCAGG - Intronic
1071686338 10:87761880-87761902 GGTCTGCCTAGTTACTCGGGAGG - Intronic
1078531093 11:12137242-12137264 AGCCTGGCGAGCTCCAAGGGCGG - Intronic
1078538664 11:12196023-12196045 AGACTGCAAAGTGACAAGGGTGG + Intronic
1078826926 11:14938601-14938623 ACCCTGCAGAGTCACAAGGGTGG - Intronic
1080562703 11:33478506-33478528 AGGCTGCATAGCAACAAGGGAGG + Intergenic
1085517720 11:77121280-77121302 AGCCTGCCTGGTTCCAGGGTTGG + Intronic
1086954905 11:92925743-92925765 ACCCTGCATAGCCACAAGGGCGG + Intergenic
1089090768 11:115872992-115873014 AGCCTGCCTCACTCCAAGGGAGG - Intergenic
1091820601 12:3472807-3472829 AGCCTCCCTAGTTCCCTGGGTGG - Intronic
1095640833 12:44483302-44483324 ACCCTGCCAAGCCACAAGGGTGG - Intergenic
1098104653 12:67056602-67056624 AGCCTGCCCAGTTCAAATGGAGG + Intergenic
1099704845 12:86138877-86138899 AGCCTGCCTTGTATCAAGAGGGG + Intronic
1100687042 12:96997680-96997702 ACCCTGCCTAACTGCAAGGGCGG + Intergenic
1107574257 13:41700010-41700032 AGCCTGGCTACTCAAAAGGGAGG - Intronic
1111313193 13:86516997-86517019 AGCCTGCAAAGCCACAAGGGTGG - Intergenic
1111601572 13:90481550-90481572 ACCCTGCAAAGATACAAGGGTGG - Intergenic
1113746987 13:112752171-112752193 GGCCTGCCTCGTTTCAAGGTGGG + Intronic
1115609154 14:35035040-35035062 TGCCTGCCTAGATACAGTGGGGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1120250338 14:82055354-82055376 AGCCTGCCTACTTTCAAAAGAGG - Intergenic
1121101100 14:91250932-91250954 GGCCTGCCTAGGTTCAAGGGAGG - Exonic
1122922861 14:104887126-104887148 AGCCTGCGTAGTGGCAAGAGCGG + Exonic
1124503112 15:30247979-30248001 AGCTGTCCTAGGTACAAGGGTGG + Intergenic
1124740444 15:32290667-32290689 AGCTGTCCTAGGTACAAGGGTGG - Intergenic
1129635449 15:77311944-77311966 AGACTGCCTAGTTAGTAGTGTGG + Intronic
1130569354 15:85026561-85026583 AGCCTGCACAGATTCAAGGGAGG + Intronic
1133926543 16:10197558-10197580 TGCCTGCATAGCTACCAGGGTGG - Intergenic
1142877536 17:2861045-2861067 AGCCTGCCATGTTCCAAGTGTGG - Intronic
1143933646 17:10458861-10458883 AGCCTGCCTTGTTACACATGAGG + Intronic
1147943638 17:44067583-44067605 AGTCTGCCTATTTCCAAGGACGG + Exonic
1152719322 17:81915135-81915157 AGCCATCCTAGTCACAGGGGAGG - Intronic
1153916508 18:9750423-9750445 AGCCTGCATTTTTACAAGGCGGG - Intronic
1156614957 18:38772366-38772388 AGCCTGCAAAGTCACAAGGGTGG - Intergenic
1157489063 18:48109658-48109680 AGACAGCCGAGTGACAAGGGAGG + Intronic
1158340653 18:56462428-56462450 AGACTTCCTAATTACAAGGCTGG - Intergenic
1163949714 19:20572185-20572207 AGCCTGCCGAGTTCCCACGGTGG - Intronic
1163968366 19:20769718-20769740 AGCCTGCCGAGTTCCCACGGTGG + Intronic
1165716497 19:38049171-38049193 AACCTTCCCAGTGACAAGGGAGG - Intronic
1167561103 19:50226647-50226669 TGCGTGCCTAGTTCCAAGGGAGG + Intronic
925860484 2:8170752-8170774 AGCCTGCCTTTTCCCAAGGGAGG + Intergenic
927956881 2:27213015-27213037 AGCCTAGCCTGTTACAAGGGTGG + Intronic
931716354 2:65032198-65032220 AGCCTTCCACGTTATAAGGGAGG - Intergenic
934614251 2:95761515-95761537 AGCCTGCCCAGGCACAAGGCAGG - Intergenic
934646657 2:96063014-96063036 AGCCTGCCCAGGCACAAGGCAGG + Intergenic
934840059 2:97619096-97619118 AGCCTGCCCAGGCACAAGGCAGG + Intergenic
940538049 2:154971520-154971542 AGCCTCCCTAATTACAAGCAGGG + Intergenic
948441664 2:237995171-237995193 AGCCTGCCTATCTACAAAGTGGG + Intronic
1170900342 20:20456485-20456507 GGCCAGCCTAGATTCAAGGGAGG - Intronic
1172596020 20:36151797-36151819 AGCCTGCCTATTTATAAGATGGG + Intronic
1173494005 20:43505901-43505923 AGCCTCCCTAGTAGCTAGGGAGG + Intergenic
1173863061 20:46296973-46296995 AGCCTGCCTAGTACCATGGGTGG - Intronic
1174524531 20:51160610-51160632 AGCCTGACTAGATCCGAGGGTGG - Intergenic
1178936522 21:36867484-36867506 AGCCTGCCTAGCTGAAAGGAGGG - Intronic
1185089265 22:48756771-48756793 GACCTGCCCAGCTACAAGGGTGG + Intronic
954807988 3:53231364-53231386 AGCCTGCCCAGCTACAAAGTTGG - Exonic
955962496 3:64355238-64355260 AGCCTGCCTAGTTACAAGGGAGG + Intronic
956358159 3:68416810-68416832 TGCCTGCCTACTCTCAAGGGGGG - Intronic
957173828 3:76778022-76778044 AGCCTGCCTGGGTGCAAGGGAGG - Intronic
962788867 3:138792530-138792552 TGCCTGGCTAATTACAAGTGTGG + Intronic
965803195 3:172515399-172515421 AACCTACCTAGATACAAGGTCGG + Intronic
967614327 3:191547044-191547066 ACCCTGCAAAGCTACAAGGGTGG - Intergenic
967888162 3:194347047-194347069 AGCCTCCCCAGTTCCCAGGGAGG - Intronic
968199677 3:196741220-196741242 ATCCTGCCTACTTATAAGAGCGG - Intronic
972250356 4:37293313-37293335 AACCTGCCTAGCTGCAGGGGTGG + Intronic
978262279 4:106774008-106774030 ACCCTGCAAAGCTACAAGGGTGG + Intergenic
983162390 4:164432308-164432330 AGCATGCCTAGTGACCAGGATGG + Intergenic
986113875 5:4750308-4750330 AGCCTGCAAATTCACAAGGGCGG - Intergenic
986837565 5:11656713-11656735 AGCTTGCATAGTTACAAAGCTGG - Intronic
987747228 5:21991627-21991649 TGCCTGCTTATTTTCAAGGGTGG + Intronic
987894264 5:23925153-23925175 TGACTTCCTAGATACAAGGGGGG + Intergenic
991667880 5:69017754-69017776 AGCCCTCCTAGATACAAGGAAGG - Intergenic
993015608 5:82531764-82531786 ACCCTGCAAAGCTACAAGGGTGG - Intergenic
993101824 5:83550128-83550150 AGCTTGCCTAGTGAGAAGTGTGG + Intronic
993215821 5:85021582-85021604 ACCCTGCAAAGTTACAAGGGTGG - Intergenic
996415170 5:123202859-123202881 AGCCTGCCCAGATTCAAGGGAGG + Intergenic
997880646 5:137586642-137586664 AGCCTGCTGAGTTTCAAGGAGGG - Intronic
998129052 5:139642180-139642202 TGCCTCCCTAGTGAAAAGGGTGG + Intergenic
1007916592 6:45567104-45567126 ATCCTTCATAGTTAGAAGGGAGG - Intronic
1008747502 6:54690685-54690707 ATCCAGCCTAGTTAAGAGGGAGG - Intergenic
1008802751 6:55390060-55390082 AGCCTTCCTATTTCCAAGGTGGG + Intronic
1009620089 6:66064059-66064081 ATCCTGCAAAGTCACAAGGGGGG + Intergenic
1013820197 6:114145527-114145549 AGCCTGCCTGATTAGAAGGAGGG + Intronic
1021887719 7:25156334-25156356 AGCCTGGCAAGTTCCAAGGTGGG - Intronic
1028480248 7:91296963-91296985 TGCCTTCCTAGTTACAAGATTGG + Intergenic
1031097501 7:117438462-117438484 AGCACCCCTAGTTGCAAGGGAGG + Intergenic
1038641073 8:29328954-29328976 AGCCTGCTCAGATCCAAGGGAGG - Intergenic
1042756933 8:72224826-72224848 AGCCTGCCTTCTCACAAGGCAGG - Intergenic
1044529393 8:93290515-93290537 ACCCTGCCTAGTGATCAGGGAGG + Intergenic
1045502063 8:102751236-102751258 ACCATGCCTAGCTGCAAGGGAGG - Intergenic
1045884330 8:107078330-107078352 AGCTTTCCTAGATACAATGGGGG + Intergenic
1049652056 8:143774575-143774597 CGCCTGCCTATTTGCAAGAGCGG - Intergenic
1055359543 9:75475149-75475171 AGCCTGCCTACCTATTAGGGTGG - Intergenic
1061803858 9:133127552-133127574 AGCCTGCCTAGGTCCTGGGGTGG + Intronic
1188105565 X:26143778-26143800 AGCCTGCAAAGCCACAAGGGTGG - Intergenic
1189186425 X:39059376-39059398 AGCCTGCATGGTTAAAAGGAAGG + Intergenic
1190818189 X:53947655-53947677 AGCCTGCTTAGATTCAAGAGTGG - Intronic
1193321640 X:80129697-80129719 AACCTGCCTAGGTTCAAGGGGGG + Intergenic
1193808066 X:86016908-86016930 ACCCTGCAGAGTTACAGGGGCGG + Intronic
1197124481 X:122928199-122928221 AGCCTGCCTAGATTCAAAGTGGG + Intergenic
1201589973 Y:15604126-15604148 ACCCTGCAAAGTCACAAGGGTGG - Intergenic