ID: 955967125

View in Genome Browser
Species Human (GRCh38)
Location 3:64399940-64399962
Sequence CAAGGTAATCAAACAGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955967121_955967125 19 Left 955967121 3:64399898-64399920 CCAGTGGTCACAGCTGACCAATG 0: 1
1: 0
2: 3
3: 14
4: 143
Right 955967125 3:64399940-64399962 CAAGGTAATCAAACAGATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 149
955967122_955967125 2 Left 955967122 3:64399915-64399937 CCAATGATTATGAGCTTCCATCT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 955967125 3:64399940-64399962 CAAGGTAATCAAACAGATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955967125 Original CRISPR CAAGGTAATCAAACAGATTC TGG Intronic
905346352 1:37313575-37313597 CAAGGCAAACAAAGAGATGCTGG - Intergenic
907749839 1:57252366-57252388 CAATGGAATCAAATAGACTCAGG - Intronic
909607000 1:77517705-77517727 TAAGGTAATAAAACATATTGAGG + Intronic
910456622 1:87404283-87404305 GAAGGTAATCAAATGGATTAGGG - Intergenic
910906022 1:92179326-92179348 CAATGGACTCACACAGATTCTGG - Intronic
913576975 1:120185301-120185323 CAAGCTACCCAAACTGATTCAGG + Intergenic
914558884 1:148796736-148796758 CAAGCTACCCAAACTGATTCAGG + Intergenic
914613949 1:149333494-149333516 CAAGCTACCCAAACTGATTCAGG - Intergenic
915845351 1:159258202-159258224 CAAGGTAATCAAAGAATTTTTGG + Intergenic
916338534 1:163700813-163700835 CAAGGTATTCACAGACATTCAGG + Intergenic
917414498 1:174794976-174794998 CATGGTTATCAGACATATTCAGG - Intronic
919623730 1:199890827-199890849 CAATGTAATCAAAAAGTCTCAGG + Intergenic
919828375 1:201520281-201520303 GAAGGTAATCACAGAGATACTGG - Intergenic
922994834 1:229947630-229947652 TAAGATAATCACAGAGATTCTGG - Intergenic
1066270775 10:33820503-33820525 CAAGTTCATCATAGAGATTCAGG + Intergenic
1067795445 10:49318108-49318130 CAAAGAAATCAAGCAGTTTCTGG + Intronic
1068334993 10:55623224-55623246 ACAGGATATCAAACAGATTCAGG + Intronic
1068823826 10:61410570-61410592 CAAAGTGATCAATCAGATGCTGG - Exonic
1069553996 10:69384789-69384811 CAATGTGATCAAACAGCTGCAGG - Exonic
1070188831 10:74092884-74092906 CAAGGCACTCAATTAGATTCTGG - Intronic
1070386682 10:75931611-75931633 GAAGGAAATAATACAGATTCTGG - Intronic
1072529203 10:96302704-96302726 AAAAGTATTCAAACAGATGCTGG - Intergenic
1073985379 10:109202439-109202461 AAAGGGAATCAAAGAGATTCAGG - Intergenic
1076036748 10:127204936-127204958 CATGGTCATCAAACAGAGCCAGG - Intronic
1079099328 11:17531135-17531157 CCAGGTGAGCAAACAGAGTCCGG - Exonic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1083587074 11:63868026-63868048 CAAAGTACTCCAACAGTTTCTGG - Intronic
1085607249 11:77912562-77912584 AAAGATAGTCAAAAAGATTCTGG + Intronic
1090052811 11:123395188-123395210 TAATGAAATAAAACAGATTCTGG + Intergenic
1094274738 12:28659676-28659698 CATAGTTATCAAACAGATTTTGG - Intergenic
1094291538 12:28855934-28855956 CAAGCTAAGGACACAGATTCTGG + Intergenic
1095735459 12:45551580-45551602 CAACGTAATCACACCCATTCTGG + Intergenic
1098363267 12:69676155-69676177 CCAGGGAATTAAACAGGTTCAGG - Intronic
1098927611 12:76368720-76368742 CAAGGGAGCCAAACAAATTCTGG - Intronic
1099721883 12:86373221-86373243 ATTTGTAATCAAACAGATTCTGG - Intronic
1100498958 12:95155024-95155046 CAAGGTAAAAAAATAGATGCAGG + Intronic
1101541828 12:105672379-105672401 CAAGGCAATTCAACAGACTCAGG - Intergenic
1102724441 12:115047837-115047859 CAACGTAATCAAATATATTGTGG + Intergenic
1103556125 12:121767543-121767565 AAAGGTTTTAAAACAGATTCTGG + Intronic
1106321189 13:28641015-28641037 CAAGGAAATCAGACTGCTTCTGG + Intergenic
1109517704 13:63465470-63465492 AAAGATAACCAAACAAATTCTGG + Intergenic
1113234696 13:108257758-108257780 CATGGTAATCAAACAATTTGAGG + Intronic
1116509436 14:45725786-45725808 AAAAATAATCAAACAAATTCTGG - Intergenic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1119607779 14:76035536-76035558 AAAGGGAAGCAAAAAGATTCTGG - Intronic
1128580329 15:68805483-68805505 GAAGATAATAAAACACATTCTGG + Intronic
1135405370 16:22193911-22193933 CAAGGAAATGATACAGATTTGGG - Intergenic
1135869390 16:26135711-26135733 CAAGGACATCAAACTGATTGTGG + Exonic
1137743725 16:50805407-50805429 AAAGGTAAGCAAACTGTTTCTGG - Intergenic
1137879338 16:52030634-52030656 CAAGGAAATAAAACATATTCGGG + Intronic
1138321241 16:56113909-56113931 CAGGGTAATCAAAAGTATTCTGG + Intergenic
1140265277 16:73415434-73415456 CAAAGTAATGAAACAGATGGTGG + Intergenic
1143383757 17:6512669-6512691 CAAGGTCATAAACCAGAGTCAGG + Intronic
1147500669 17:40960414-40960436 CCAGGTTATCAATCAGACTCTGG + Exonic
1147551069 17:41442077-41442099 CAAGGTGAAGAAACAGTTTCTGG - Intergenic
1149268108 17:54949740-54949762 TAAGCTAATGAAACAAATTCAGG + Intronic
1152598579 17:81250173-81250195 CAAAAGAATCAAACAGGTTCAGG + Intronic
1153088231 18:1313992-1314014 AAATGTATTAAAACAGATTCCGG - Intergenic
1154182712 18:12150417-12150439 CTAGAGAATCAAACAAATTCAGG + Intergenic
1155219649 18:23672499-23672521 GAAGGTAATCACAGAGATACTGG + Intergenic
1155813101 18:30263770-30263792 AAAGGTAATTAAATATATTCTGG - Intergenic
1164503603 19:28839996-28840018 GAAGGAATTCAAACAGCTTCGGG + Intergenic
928051593 2:28002543-28002565 CAATGTAATTACTCAGATTCAGG + Intronic
932906572 2:75759601-75759623 AAAGTTAAACAAACAGATACTGG + Intergenic
933586044 2:84180346-84180368 CCAGGGAATCACACAGATTTGGG + Intergenic
935494399 2:103761478-103761500 CAAACTACTCAAACTGATTCAGG + Intergenic
936247311 2:110839677-110839699 CAAGCTATTCAAACAGTATCTGG + Intronic
937396379 2:121539325-121539347 CAGGATAAAGAAACAGATTCGGG + Intronic
939714117 2:145561652-145561674 CAAGGTTGGCAAATAGATTCTGG - Intergenic
942051746 2:172146865-172146887 CCAGGGAATTAAACAGATTTGGG + Intergenic
942457887 2:176150482-176150504 CAAGGTAATAAAACAGAACGAGG - Intergenic
944321750 2:198353301-198353323 CAAAGTAATCAATGAGCTTCTGG + Intronic
946473964 2:219990195-219990217 AAAGGTAATCAGACAAATTAGGG - Intergenic
1169040037 20:2485926-2485948 CAAGTAAACCAAACAGACTCAGG - Intronic
1170296570 20:14832592-14832614 CAAGGGAATCCAACACAGTCAGG + Intronic
1171951051 20:31422878-31422900 CAAGGTAACCAAACAGATGAGGG + Intergenic
1177951677 21:27545637-27545659 CAATGAAATGAAACAGGTTCTGG + Intergenic
949120309 3:376018-376040 CAAGGTAATTAAGCAGATGAAGG + Intronic
950994078 3:17475587-17475609 GAAGATAATTAAACAGATACCGG - Intronic
951819196 3:26789968-26789990 AAAAGGAATCAAACAGATTATGG - Intergenic
952794951 3:37230650-37230672 CAATGTAATTAATCAGAATCGGG - Intergenic
953517740 3:43612756-43612778 CAATCTGATTAAACAGATTCAGG + Intronic
954501071 3:51014444-51014466 TAATATGATCAAACAGATTCAGG - Intronic
955824704 3:62933507-62933529 CAAGTTAATAAAAAAAATTCAGG + Intergenic
955967125 3:64399940-64399962 CAAGGTAATCAAACAGATTCTGG + Intronic
956393131 3:68795864-68795886 CCAGGTATTCAAACAGATGTGGG + Intronic
957079979 3:75629037-75629059 CTAGGTAATTAAAAAGAGTCTGG + Intergenic
957346966 3:78973675-78973697 CAAGGCAATTAAATAAATTCTGG + Intronic
959477104 3:106824359-106824381 CAAGGGAATCAAACATCTTGAGG - Intergenic
963035781 3:141027409-141027431 GATGGTAAGCAAATAGATTCTGG - Intergenic
963436503 3:145275180-145275202 CTAGGTGAACAAACAGAATCAGG - Intergenic
965311876 3:167138530-167138552 CAATGTAAGCAAAAAGATACTGG + Intergenic
966272118 3:178120272-178120294 GAAGGGAATCCAACAGATTTAGG - Intergenic
966651475 3:182305681-182305703 CAAGGTGACCAAAAACATTCTGG + Intergenic
969116284 4:4872598-4872620 CAAGGTCACCAAGCAGTTTCTGG + Intergenic
970045610 4:11850077-11850099 GAAAGAAATCAAACAAATTCTGG + Intergenic
971504872 4:27355654-27355676 CAGGGTAATCAAAGAGAAACGGG - Intergenic
971899198 4:32636322-32636344 CAAGAAAATCAAACAGATTTTGG - Intergenic
974869766 4:67626518-67626540 AATGGTAACCAAACAGATGCAGG - Intronic
975375862 4:73645323-73645345 GAAAATAATCAAACAAATTCTGG - Intergenic
975411182 4:74052514-74052536 CAAAGTAATCACACAGACTATGG - Intergenic
975453424 4:74557899-74557921 CTAGGTAATCTGACAGCTTCTGG + Intergenic
978163292 4:105575513-105575535 CAAGGAACTCAAACAAATTAAGG - Intronic
978290384 4:107131161-107131183 CAAGGTAACCCAATAGATTCTGG - Intronic
979666266 4:123314361-123314383 AAAGACACTCAAACAGATTCTGG - Exonic
982204729 4:152989296-152989318 CAAGGTCACCAAGCAGATACAGG - Intergenic
983096327 4:163566482-163566504 CAAGGTAACCTAACAGACTGTGG + Intronic
984301273 4:177921492-177921514 AAAGGTAAACAATCAAATTCAGG - Intronic
987884012 5:23789238-23789260 CAAATTAATCTAACAGATGCAGG - Intergenic
987982515 5:25104735-25104757 CAAGGTAAACACAGAGAGTCAGG + Intergenic
990032194 5:51275479-51275501 GAAGGTAATCACAGAGATACTGG - Intergenic
993122055 5:83787279-83787301 CCATGTATTCAAACAAATTCTGG - Intergenic
995299100 5:110557321-110557343 CAAGGAGATCAATAAGATTCAGG - Intronic
998299574 5:141004773-141004795 AAAGGTAAACAGGCAGATTCTGG + Intronic
998628509 5:143872779-143872801 CAATGAAATGAAACAGATTCTGG - Intergenic
998824330 5:146085411-146085433 CTAGGTTTTCATACAGATTCGGG + Intronic
1001383952 5:171323043-171323065 CAAGCTAAGTAAACAGATTGGGG - Intergenic
1002372725 5:178767933-178767955 CAAGGAAATGAACCAGGTTCAGG - Intergenic
1002663697 5:180807778-180807800 CAAGATGATGAAACACATTCAGG + Intronic
1005453889 6:26000313-26000335 AAAGGTAACCAAACAGAATAGGG + Intergenic
1006534576 6:34687947-34687969 AAAGGTACTCAAACAAATACAGG + Intronic
1011291046 6:85778094-85778116 CCAAGTATTCAAACAGACTCAGG + Intergenic
1013580412 6:111528722-111528744 CAAAGTAAAGAAACAGATTTCGG + Intergenic
1014025887 6:116645257-116645279 CAAGTTAATGAAACAGAATAAGG + Intronic
1015014673 6:128397623-128397645 CAAAGTCATCATACAGATCCTGG + Exonic
1015059166 6:128941509-128941531 CAAGGTAATCAAACTAAGTGAGG - Intronic
1015421320 6:133012796-133012818 AAAGGTAATCAAAAGGAGTCAGG + Intergenic
1016505502 6:144774208-144774230 CAAAGTAACCAAATACATTCTGG + Intronic
1017791334 6:157802206-157802228 GAAGGTGTTCAAACAGATGCTGG + Intronic
1020748251 7:12106353-12106375 GAAAGGAATCAAACAGATTGTGG - Intergenic
1025845757 7:65195659-65195681 AAAGATAGTCAAAAAGATTCTGG - Intergenic
1025895979 7:65701373-65701395 AAAGATAGTCAAAAAGATTCTGG - Intergenic
1027893914 7:84015835-84015857 CAGGGAAATTATACAGATTCTGG + Intronic
1028865102 7:95700126-95700148 CAAGGTAATTCAACATATACAGG - Intergenic
1031708388 7:125012089-125012111 CAATGTAATAAAACTCATTCTGG - Intergenic
1031968101 7:128042631-128042653 TTAGGAAATCAAACAGGTTCAGG - Intronic
1034024929 7:147690628-147690650 CAAGGAGAGCAAATAGATTCTGG + Intronic
1036062228 8:5336368-5336390 CAAGTTCATCAAATTGATTCTGG + Intergenic
1043089910 8:75886860-75886882 CAAGGTAATGAAAATGATTGTGG - Intergenic
1045134494 8:99199637-99199659 GAATGTAATCAAACAGAATTAGG - Intronic
1045148850 8:99379614-99379636 CAATGTAATCAATCAAATTTAGG - Intronic
1046712289 8:117523511-117523533 GAAGGTAATCACAGAGATACTGG + Intronic
1047514685 8:125543735-125543757 CAAGGTACTTAAACAGTGTCTGG + Intergenic
1050576562 9:7002252-7002274 CTAGGTAATATAAAAGATTCTGG - Intronic
1050797579 9:9563361-9563383 TAAGGTAATTAAAAAGATACTGG - Intronic
1051095126 9:13457502-13457524 AAAGGCCATCAAAGAGATTCTGG + Intergenic
1052804713 9:33002482-33002504 CAAGGTAATCAGACATCATCTGG - Intronic
1055649442 9:78392877-78392899 GAAGATAATTAAACAGATGCAGG + Intergenic
1056888645 9:90468622-90468644 CAAGGTAATCACACTGCTTGGGG - Intergenic
1058975241 9:110120330-110120352 CAAGGGAACTCAACAGATTCGGG + Intronic
1059984340 9:119807517-119807539 CAAGGTAATCCAGCAGAGTAAGG + Intergenic
1187369357 X:18691702-18691724 CAAGATAAAGAAACAGATTGTGG + Intronic
1189686660 X:43571382-43571404 CAAGGTAATCAATAACAATCAGG - Intergenic
1197825361 X:130584505-130584527 CAAATTAATGAAACAGATTCAGG + Intergenic
1198199777 X:134404143-134404165 CAAGGTAATTAAAAACCTTCTGG + Intronic
1199697985 X:150357308-150357330 CCAGGTAAGGAAACAGATTGGGG - Intergenic
1199930122 X:152509331-152509353 AAAGGAAAGCAAACAGTTTCAGG + Intergenic