ID: 955967319

View in Genome Browser
Species Human (GRCh38)
Location 3:64401944-64401966
Sequence ATGAAGAAATGGGCTGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955967319 Original CRISPR ATGAAGAAATGGGCTGATAG AGG (reversed) Intronic
900320664 1:2081900-2081922 AGGCAGAAATGGGCAGAGAGCGG + Intronic
901740974 1:11341702-11341724 GTGAAGGAGTGAGCTGATAGGGG + Intergenic
902179603 1:14677939-14677961 GTGCAGAAATGGGCTGTTTGGGG + Intronic
902765690 1:18613308-18613330 AAGAGGAAATGGGCTCAAAGAGG + Intergenic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903739761 1:25552015-25552037 ATGAAGAAATGGCCTCAGAGAGG + Intronic
904009564 1:27382151-27382173 ATGAGGAAATAGGCAGAGAGAGG + Intronic
904771879 1:32885562-32885584 ATGAAGAAATGGGCTCAAAGGGG - Intergenic
904846349 1:33420919-33420941 ATGAAGAAACAGGCTCAAAGAGG - Intronic
905027879 1:34863730-34863752 ATGAGGAAATGGGCTTGGAGAGG - Intergenic
905067967 1:35199700-35199722 ATGAAGAAATAGGCTGCATGCGG - Intergenic
905524380 1:38625246-38625268 ATGAATAGATGGGGGGATAGAGG - Intergenic
905936844 1:41831231-41831253 GGGAAGAACTGGGCTGAGAGTGG + Intronic
905990129 1:42330007-42330029 ATGAGGAAATGGGCACAGAGAGG - Intronic
906680626 1:47723445-47723467 ATCAAGGAAGGGGCTGCTAGGGG + Intergenic
906808830 1:48805789-48805811 ATGAGGAAACAGGCTGAGAGAGG - Intronic
907749008 1:57244370-57244392 AGGAACAAATGGGTTGATAAAGG + Intronic
908315060 1:62924411-62924433 ATAAAGAAATAGGCAGAGAGGGG + Intergenic
908329723 1:63059175-63059197 ATGAAGAAATGGGGAGTTTGAGG + Intergenic
908498288 1:64717320-64717342 ATGAAGAAACAGGATGAAAGAGG - Intergenic
908797987 1:67850566-67850588 ATGAAGAAAGAGGCTCAGAGAGG - Intergenic
909434697 1:75627387-75627409 ATGAAGAAAGGGACTAAGAGTGG + Intergenic
910693284 1:89986050-89986072 AAAAAGAAATTGGCTGAAAGAGG + Intergenic
911153423 1:94617281-94617303 ATGAGGAAATAGGCTTAGAGAGG + Intergenic
912921354 1:113870341-113870363 GTGAAGAAATGGGTGGAAAGAGG - Intronic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
914374363 1:147060774-147060796 ATGAAGAAAAGCTCTGATATGGG - Intergenic
915576780 1:156784418-156784440 AGGAAGAAATGAGTAGATAGAGG + Intronic
916406170 1:164500158-164500180 AAGAAAAAATGGGATGATTGAGG + Intergenic
919844366 1:201632000-201632022 GAGAAGAAACAGGCTGATAGAGG - Intronic
920908204 1:210190700-210190722 ATGAAGAATTATGCTGATATAGG - Intergenic
920954554 1:210606148-210606170 ATGAAGAAATAGGCTGGGTGTGG - Intronic
922203811 1:223429463-223429485 AAGCAGAAATGGGCTGAGAGAGG + Intergenic
922672314 1:227520099-227520121 ATGAAAAATGGGGCTGAGAGGGG + Intergenic
923000016 1:229999460-229999482 ATGAGGAAATGGAGTGACAGTGG + Intergenic
923136251 1:231122745-231122767 ATGAACAATTGGGTTGATGGAGG - Intergenic
924006814 1:239621246-239621268 ATGAAGAAATGGGTGGTTGGTGG - Intronic
1063499141 10:6537413-6537435 ATGTGGAAATGGGCTCAGAGAGG + Intronic
1065786976 10:29225123-29225145 ATGAGGAAATGGGCTTAAAAAGG - Intergenic
1067396065 10:45919840-45919862 ATGGAGAATGGGGATGATAGAGG - Intergenic
1069242814 10:66163338-66163360 AGGAAGGAATAGGCTGCTAGGGG + Intronic
1069568180 10:69477721-69477743 ATGAAGAACTGGGGGGAAAGGGG - Intronic
1070248023 10:74749976-74749998 AGAAAGAAATGGGCTGGGAGCGG + Intergenic
1071100529 10:82031785-82031807 ATGATGAAATGGACTTATGGGGG - Intronic
1071251636 10:83825171-83825193 ATGAACAAATAGGCTGAGACTGG + Intergenic
1071484646 10:86090997-86091019 AGGAAGGAATGGGCTACTAGGGG - Intronic
1073267312 10:102235488-102235510 ATGAAGAAATGTGCTCAGAGAGG - Intronic
1074231857 10:111545505-111545527 GTGAAGAAAGGGGGTGATATTGG - Intergenic
1074261253 10:111855682-111855704 ATGGAAGAATGGGCTGAGAGAGG - Intergenic
1075183126 10:120230007-120230029 ATGAAGAAAAGGACTGCTATGGG - Intergenic
1076131981 10:128019622-128019644 ATGAATGAATGGGCTGACATAGG - Intronic
1078635337 11:13044392-13044414 AGGAGGAAATGGGCTCAGAGTGG + Intergenic
1078730245 11:13966813-13966835 ATGGAGAAATTGGCTCAGAGAGG - Intronic
1078859564 11:15234833-15234855 ATTAAGGAATGGCCTGACAGAGG - Intronic
1082902344 11:58268475-58268497 ATGAAGCAAAGGGCTAACAGAGG + Intergenic
1083250229 11:61461860-61461882 ATGAATAAATGGGTGGAGAGAGG - Intronic
1083348950 11:62013557-62013579 AGGAAGCAATGGGGTGATGGGGG - Intergenic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084144051 11:67254519-67254541 GTGAAGAAATGAGCTGATGTGGG - Intronic
1085196726 11:74677104-74677126 CTGAAGAAATCGGCTGGGAGAGG + Intergenic
1085606565 11:77905164-77905186 AAGACGAAATGGGCTGGGAGTGG + Intronic
1085814753 11:79726084-79726106 ATGAAGAAAAGGGAGGATACTGG - Intergenic
1086344927 11:85886567-85886589 ATAAAGAAATGGGCGGGTGGGGG + Intronic
1086555405 11:88104403-88104425 ATGAAAATATGGTCAGATAGAGG + Intergenic
1086586265 11:88456100-88456122 ATGAAGGCATTGTCTGATAGAGG + Intergenic
1086594146 11:88551234-88551256 ATGTGGAAAGGGGATGATAGGGG - Intronic
1087152807 11:94873590-94873612 ATGAGGAAATGGGCTCAGAAAGG + Exonic
1087295639 11:96369989-96370011 AAGAAGAAATGGGTTCAGAGAGG + Intronic
1087382409 11:97423445-97423467 ATTCAGAAATGTGCTGACAGTGG + Intergenic
1087812956 11:102628295-102628317 GTGAAGAAATGGGCTCATGGAGG + Intergenic
1088388128 11:109282056-109282078 ATGTAGTAATGGCCTGCTAGGGG + Intergenic
1088984423 11:114892970-114892992 AAGGAGAAATGACCTGATAGAGG + Intergenic
1089399322 11:118155353-118155375 ATGAAGAAAGAGGCTCAGAGAGG + Intergenic
1089929512 11:122296105-122296127 ATGAAGAAATAGGTTCAGAGAGG - Intergenic
1089994422 11:122891876-122891898 ATCAAGGATTGAGCTGATAGAGG + Intronic
1091148889 11:133307307-133307329 AAGATGAAATGGCATGATAGGGG + Intronic
1093126039 12:15329793-15329815 ATGAAAATGTGGGCTGCTAGAGG + Intronic
1095664319 12:44778077-44778099 ATGAAGAAATGGGGGGAGTGTGG - Intronic
1097935639 12:65247235-65247257 AAGAAGAAATTGGCAGATATTGG + Exonic
1097954037 12:65464899-65464921 ATGAAGAAATAGGCACAGAGAGG - Exonic
1098069793 12:66660637-66660659 ATGAAACAATGGGCTGAAACTGG - Intronic
1100385895 12:94104420-94104442 ATGAAGTAATGGGATGATGCTGG + Intergenic
1101020722 12:100550955-100550977 ATGTAGAAATGGGCTTAGAGAGG + Intronic
1101194325 12:102367345-102367367 ATGAAGAAATGTGTTGATGATGG - Intergenic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101918454 12:108913939-108913961 ATGAAGAAATGGGCTGGGCATGG - Intronic
1102766883 12:115441065-115441087 ATGAAGAAATAGGCTTAGAGGGG + Intergenic
1104359075 12:128115133-128115155 ATGAAGAAATGGGCTGGGTGTGG - Intergenic
1105644138 13:22298719-22298741 ATGAAGACAGGGGGTGCTAGAGG - Intergenic
1106303600 13:28491537-28491559 TGGAAGAGATGGGCTGGTAGAGG - Intronic
1106672168 13:31917855-31917877 ATGAAGACTTGGTCAGATAGGGG + Intergenic
1107064257 13:36195598-36195620 ATGATGGGATGCGCTGATAGGGG + Intronic
1107439290 13:40410281-40410303 ATGCACAAATGGGCTGAGCGCGG - Intergenic
1107806720 13:44160323-44160345 ATGAAGGAAAGGACTGGTAGAGG - Intronic
1109016267 13:57019082-57019104 AAGAAGAACTGGGCTGGTTGCGG - Intergenic
1109068244 13:57729135-57729157 ATGGAGTGATGGGCTGATAATGG - Exonic
1109598120 13:64584574-64584596 AAGAAGAAATTGGGTCATAGTGG + Intergenic
1109757520 13:66779954-66779976 ATGGAGAAATAGGGTGATATAGG + Intronic
1111363765 13:87212755-87212777 ATAAAAAAATGGGCTGAGTGCGG + Intergenic
1111509712 13:89244809-89244831 ATGATGACATGGGTTGACAGAGG - Intergenic
1112885466 13:104165323-104165345 ATGATTAAATGAGCTAATAGCGG + Intergenic
1112888347 13:104201788-104201810 AGGAAGTAATGGGCTGACAATGG + Intergenic
1113220128 13:108090950-108090972 AAGAAGAAATGGGGTAAAAGGGG + Intergenic
1113641474 13:111960530-111960552 ATGAATGAATGGGTGGATAGAGG + Intergenic
1116536193 14:46034336-46034358 AGGAAGAAATGGGTTGGTAGAGG - Intergenic
1116663316 14:47741086-47741108 TTGAATAGATGGGCTGAAAGTGG - Intergenic
1117477892 14:56116168-56116190 ATGAGCAAATGGGCTGAGTGAGG - Intergenic
1117703272 14:58437034-58437056 ATGAAGAAATGGATTGGAAGAGG + Intronic
1117768389 14:59107353-59107375 AGGCAGAAATGGGTTGCTAGGGG - Intergenic
1118162220 14:63301934-63301956 ATGCAGGAATGGGCTGCTTGGGG - Intergenic
1118309940 14:64684761-64684783 ATGAAGATAAGGGCAGATATGGG - Intergenic
1120505597 14:85351524-85351546 ACTAGGAAATGGGCTTATAGAGG - Intergenic
1125366667 15:38924525-38924547 AGTAAGAAATAGGCTGACAGTGG - Intergenic
1125900131 15:43338463-43338485 ATGAAAAAATAGGCTTAAAGAGG + Intronic
1126408083 15:48343591-48343613 ATGCAGAAATGGGCTCAGAGAGG + Intergenic
1127564197 15:60170405-60170427 GTGAAGGAATGGGATGATTGGGG - Intergenic
1127805725 15:62518322-62518344 ATAAAGAAATGTGCTGGTGGTGG - Intronic
1128414931 15:67436428-67436450 AGGCAGAAATGGGCTGCTAGGGG - Intronic
1128576879 15:68782360-68782382 ATGAAGAAATAGGCTCAGAAAGG + Intronic
1129575731 15:76743075-76743097 ATGAACAAATAGGCTCAGAGAGG + Intronic
1130287503 15:82568181-82568203 ATGAGGAAATAGGCTCATGGAGG - Intronic
1130408975 15:83628450-83628472 AGCAAGAAATGGGCTGAGCGTGG + Intergenic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1130756713 15:86771969-86771991 ATGAAGTAAGGGCCTGAGAGGGG + Intronic
1131116567 15:89799705-89799727 ATGAGGAACTGGGCTGCCAGTGG + Intronic
1132219344 15:100093622-100093644 AAGTAGAAATCAGCTGATAGTGG - Intronic
1133003758 16:2865793-2865815 ATGAGGAAATTGGCTCAGAGAGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1134236969 16:12474175-12474197 CTGAAGTAATGGGCTCAGAGAGG - Intronic
1134794154 16:17019241-17019263 CTGAAGACAGGGGCAGATAGTGG - Intergenic
1134860971 16:17560543-17560565 ATAAATAGATGGGTTGATAGAGG + Intergenic
1136471880 16:30486208-30486230 AAGAAGCAATGGGCTGAGCGTGG + Intronic
1138230714 16:55333864-55333886 ATGAGGAAATAGGCTCAGAGAGG + Intergenic
1138864162 16:60795946-60795968 ATGAATAAGTGGGCTGGGAGTGG + Intergenic
1139441583 16:66970608-66970630 ATGAAGAGATGGGCTTAGAGGGG - Intronic
1141254364 16:82386791-82386813 ATGGAGAAATTTGCAGATAGAGG - Intergenic
1141394829 16:83695346-83695368 AAGAAGAAATGGGCCCAAAGAGG - Intronic
1146899787 17:36575935-36575957 ATGAAGATATGGGCTGGGCGCGG - Intronic
1147773218 17:42882158-42882180 ATGAAGAAATGGGTTCAGATGGG - Intergenic
1148327641 17:46792892-46792914 ATGATGACATGGGCTCAGAGAGG + Intronic
1150645476 17:66975111-66975133 CTTCAGAAATGGGGTGATAGCGG - Intronic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152248895 17:79201269-79201291 AGAAAGTAATGGGCTGAGAGAGG + Intronic
1153104498 18:1511272-1511294 TTAAAGGCATGGGCTGATAGTGG + Intergenic
1153314314 18:3707055-3707077 ATGGAGAAATGGGTTGTTAAGGG + Intronic
1153372192 18:4331669-4331691 AAGGAGAAATGGGCTTACAGAGG - Intronic
1156423572 18:36982997-36983019 ATGAACAAAGGGGATGATACTGG + Intronic
1158429282 18:57369668-57369690 ATGAATGAATGGGCAGATGGGGG + Intronic
1158614025 18:58969362-58969384 ATGAAGAAAGGGTATGAGAGTGG - Intronic
1158837188 18:61343344-61343366 ATGAAGAAATGGGGTCAAAAAGG + Intronic
1159201878 18:65197061-65197083 ATGAAAAAATGGGCTGAGCGTGG - Intergenic
1159375985 18:67593883-67593905 ATGGAGGAAGGGGCTCATAGAGG - Intergenic
1159473347 18:68884521-68884543 ATGACGAAATGGGCAGATGTAGG + Intronic
1160327996 18:77968238-77968260 ATGAGGACATGGGATTATAGAGG + Intergenic
1162769504 19:12940599-12940621 ATGAAGAGATGGACGGAGAGTGG + Exonic
1163406980 19:17128888-17128910 CTAAAGAAAGGGGCTGAAAGAGG - Intronic
1163675422 19:18653405-18653427 ATGAAAAGATGGGTGGATAGGGG - Intronic
1164174849 19:22763088-22763110 TTGAAGAAGTGGGGTGAAAGTGG - Intronic
1164590648 19:29505102-29505124 CTGAAGAAATGGGCTCCCAGAGG + Intergenic
1166496122 19:43304504-43304526 CTGGAGAAAGGGACTGATAGGGG + Intergenic
1166840606 19:45694785-45694807 ATGAGGAAATGGGCTCAGAGAGG - Intronic
1166905560 19:46106174-46106196 ATGAAGAAAGGTGCTGAGATAGG + Intergenic
1167242867 19:48355502-48355524 ATGTATGAATGGGCTGATGGCGG + Intronic
1167706346 19:51083240-51083262 AGGAAGAGATGGACTGAGAGAGG + Intronic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
925759181 2:7167855-7167877 TTGAAGAAATGTAATGATAGTGG - Intergenic
926641133 2:15238126-15238148 ATGAAGAAATGAGAAGACAGTGG - Intronic
926909881 2:17842708-17842730 AAGAAGAAAGGGGCTGAGCGTGG + Intergenic
927189527 2:20507867-20507889 ATGGAGAAATGGGTTCAGAGAGG + Intergenic
929761510 2:44811152-44811174 AAGAAGCAATGGGCTGGGAGGGG - Intergenic
931762315 2:65429736-65429758 CTGAAGAAATGGGCTTATAGGGG - Intronic
934574719 2:95392632-95392654 ATGAAGCAATGGGCAGACGGGGG - Intergenic
936661203 2:114546107-114546129 ATGAAAAAATGGACTGATACAGG - Intronic
938571276 2:132564037-132564059 AAGGTGAAATGGGCTGTTAGAGG - Intronic
940109188 2:150132718-150132740 ATGAAGAAAAGGGAAGAGAGGGG + Intergenic
940448507 2:153808378-153808400 AAGAAAAAATGGGCTGAAAATGG - Intergenic
941139360 2:161759466-161759488 ATGCAGAAATGGGGAGATATTGG - Intronic
942010156 2:171753962-171753984 ATGAAGGAATAGGCTTAGAGAGG - Intergenic
943309188 2:186305965-186305987 ATGATGAATTGGACGGATAGTGG - Intergenic
944214999 2:197246096-197246118 AGGAAGACATGGGGTGACAGAGG + Intronic
944509458 2:200450525-200450547 ATGAAGAAAGGGGAAGAGAGAGG - Intronic
944661485 2:201925126-201925148 ATGAGGAAATGGAGGGATAGAGG - Intergenic
945120862 2:206455601-206455623 ATGAAGAGATGGGCTGAAACTGG - Intronic
945160794 2:206888439-206888461 AGGAAGAAATGGGGTGATGTTGG + Intergenic
945308304 2:208281404-208281426 ATGAAGGTATGGGATAATAGTGG - Intronic
945421604 2:209644289-209644311 CTGTATAAATGGGGTGATAGAGG - Intronic
945801296 2:214434601-214434623 ATGAGGAAATGGGCTGAGAAAGG - Intronic
947248160 2:228073126-228073148 ATGAGGAAATTAGCTGAGAGGGG + Intronic
947397948 2:229705097-229705119 CTGTAGCAATGGGCTGATGGGGG - Intronic
1172218637 20:33255651-33255673 ATAAAGAAAAGGGGTGACAGAGG + Intergenic
1172558538 20:35865343-35865365 ATGAAAAAATTGGCTGAGAGTGG + Intronic
1173117762 20:40262486-40262508 AGGAGGAAATGGGTTGAGAGAGG + Intergenic
1173133018 20:40412101-40412123 ATGAGGAAACGGGATGAGAGAGG - Intergenic
1173846449 20:46191631-46191653 ATGAGGAAACGGGCTCAGAGGGG + Intronic
1175441586 20:58996102-58996124 ATTAAGAAATGGGGGGAAAGCGG - Intronic
1176671632 21:9740271-9740293 GTGATGAGATGGGCTGATAGAGG - Intergenic
1178194620 21:30329486-30329508 ATGAAAAAAGGGGCTATTAGAGG + Intergenic
1182058233 22:27378050-27378072 ATGAGGAACTGGGCTCAGAGAGG + Intergenic
1182972594 22:34591657-34591679 AGAAAATAATGGGCTGATAGGGG + Intergenic
1183389760 22:37538876-37538898 ATGAAGAAGAGGGCTGATGTGGG + Intergenic
1184087674 22:42274915-42274937 AAGAAGAACTGGGATGATAAAGG - Intronic
949118324 3:355912-355934 ATGAAGAAATGGGTTTGAAGAGG - Intronic
949163421 3:909392-909414 ATGAAGAATAGGGCTGACTGGGG + Intergenic
949464861 3:4333665-4333687 ATCACAAAATGGGCTGATTGGGG - Intronic
951145078 3:19217004-19217026 ATGAAGAAATGATCTCAAAGAGG - Intronic
951165106 3:19476155-19476177 AAGAAGAAGAGGGCTAATAGAGG - Intronic
952150634 3:30586268-30586290 AAGAGGAAGTGTGCTGATAGTGG - Intergenic
952780247 3:37090055-37090077 ATGAAGAGTTTGGCTGATAGTGG + Intronic
953778069 3:45840238-45840260 ATGAAGAAAGGGGGTAAAAGTGG + Intronic
954269065 3:49493197-49493219 ATGAAAAAATTGGCTGAGTGTGG - Intronic
954438251 3:50507491-50507513 ATGAAGAAATGGGCTTGCAGAGG - Intergenic
954861096 3:53691044-53691066 ATGAAGATATGTGATGATATTGG + Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955967319 3:64401944-64401966 ATGAAGAAATGGGCTGATAGAGG - Intronic
956935550 3:74096737-74096759 AAGAATAAACGGGATGATAGAGG - Intergenic
956995783 3:74824963-74824985 AGGCAGGAATGGGCTGTTAGGGG + Intergenic
957350043 3:79012883-79012905 TTGAAGGAAGGGGCTGAAAGTGG + Intronic
959751002 3:109834962-109834984 ATGAAGAAACAGGCTTAGAGAGG + Intergenic
959757055 3:109911289-109911311 AGGAAGGAATGGCCTGCTAGGGG + Intergenic
960070082 3:113419765-113419787 ATAAGGAAATGGGCTTATAGAGG - Intronic
960087351 3:113605414-113605436 ATGAAGCAATGGGCTGGGTGTGG - Intronic
960663390 3:120085980-120086002 CTGAAGAAAAAGGGTGATAGTGG - Intronic
962102014 3:132352486-132352508 ATGAAGAAATTGGCTGGGCGTGG - Intronic
963017947 3:140843606-140843628 GTGAAGAAATGAGATGACAGTGG + Intergenic
963774961 3:149429336-149429358 ATTAAGAAAAGGGCTGCAAGAGG + Intergenic
963860812 3:150308483-150308505 ATGTAGACTTGGGCTGGTAGAGG + Intergenic
964091814 3:152886150-152886172 GTGAAGAAAATGGCTGACAGGGG - Intergenic
964478489 3:157119282-157119304 ATATAGAATTGGGTTGATAGTGG - Intergenic
965044933 3:163564810-163564832 ATGTAGGAATGGTCTAATAGGGG - Intergenic
966209711 3:177440461-177440483 ATGAGGAAATGGGCTAGGAGAGG - Intergenic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966795441 3:183709002-183709024 ATAAAAAAATGAGCTGAGAGTGG + Intronic
967330644 3:188286043-188286065 AGGCGGAAATGGGCTTATAGAGG + Intronic
967544773 3:190712186-190712208 TAGAGGAAATGGGCTGAGAGAGG - Intergenic
967560590 3:190913789-190913811 TTGAATAAAAGGGCTGAAAGTGG + Intergenic
968894187 4:3389211-3389233 CAGAAGAAAGGGGCTGATAATGG + Intronic
970146168 4:13038301-13038323 ATGCAGAAATGGCCTAATACAGG + Intergenic
970289660 4:14557463-14557485 AAGAAGAAATTAACTGATAGAGG - Intergenic
970434358 4:16019070-16019092 ATGAGGAAATTGGCTCAGAGTGG - Intronic
971173524 4:24258839-24258861 ATGAATAAATGGTCTGAGAGTGG - Intergenic
972243611 4:37221238-37221260 GTGAAGAAATAGGCTCAGAGAGG - Intergenic
972807747 4:42547211-42547233 ATGAACAACTGGGTAGATAGAGG - Intronic
973261342 4:48167116-48167138 ATAAATATATGGGCAGATAGGGG - Intronic
974373705 4:61049351-61049373 ATGAAAAAATGGGATGAGACAGG + Intergenic
974468742 4:62291993-62292015 ATGCAAAAATGGGCTAATACAGG + Intergenic
975186024 4:71403925-71403947 ATTAAGAAATGGGCTCTTATGGG - Intronic
975388300 4:73785319-73785341 ATGAACAAATGGGCTGGGCGCGG + Intergenic
976856385 4:89609786-89609808 AGGCAGGAATGGGCTGCTAGGGG - Intergenic
976963204 4:91003850-91003872 GGGAAGAAATGGCCTGCTAGGGG + Intronic
978387409 4:108190096-108190118 ATCAAGGAAGGGGCTGACAGTGG - Intergenic
978440993 4:108732955-108732977 ATGAGGAAATGGGCTTATGGTGG - Intergenic
978726787 4:111978096-111978118 AGGCAGGAATGGGCTGCTAGGGG + Intergenic
979283588 4:118895575-118895597 ATGAACCAATGGGCTTGTAGGGG - Intronic
979909882 4:126349960-126349982 ATGATGAAATTGGCAGAAAGAGG + Intergenic
980012110 4:127607965-127607987 AGGAAGAAATGGCTTCATAGTGG - Intergenic
980450013 4:132958697-132958719 ATGAAGAGGTGGGCAGAGAGGGG + Intergenic
980919712 4:139071043-139071065 ATGAGGAAATGGGCAGTAAGTGG - Intronic
981935805 4:150238764-150238786 ATGAAGAAATGTGCTCAGAGAGG + Intronic
982251342 4:153410069-153410091 ATGAGGAAGTAGGCTGAGAGAGG - Intronic
982680246 4:158419509-158419531 AGGTAGGAATGGGCTGCTAGGGG + Intronic
983589271 4:169389764-169389786 ATGAAGAAATGGGCTGGGCATGG - Intergenic
984776725 4:183487568-183487590 ATGAAGAAATAGGCTTACAGAGG - Intergenic
984891973 4:184502335-184502357 ATGAGGAAATAGGCTCAGAGTGG - Intergenic
985403109 4:189611556-189611578 GTGATGAGATGGGCTGACAGAGG + Intergenic
988344518 5:30020643-30020665 AGGAAGAAATGGCCTGCTAGAGG - Intergenic
990601355 5:57361622-57361644 ATGGAGAAAGGGACTCATAGTGG + Intergenic
991392151 5:66157139-66157161 ATTAAAAAATGTGCTTATAGTGG + Intronic
992871417 5:81009123-81009145 ATGAGGAAACAGGCTGAAAGAGG - Intronic
994689068 5:102993999-102994021 CTGAAGCAATGGGCTGACAGTGG + Intronic
995471015 5:112502276-112502298 ATGATGAAATGTTCTGATAGTGG - Intergenic
995473108 5:112523750-112523772 ATGCAGGAATGGCCTGCTAGGGG + Intergenic
995817717 5:116191155-116191177 ATGCAGGAATGGCCTGCTAGGGG - Intronic
997144446 5:131417510-131417532 AACAAGAAAAGGGCTGAAAGGGG - Intergenic
997636442 5:135410060-135410082 ATGAAGACATGGACTGATATTGG - Intergenic
997750131 5:136336380-136336402 GTGAAGAAATAGACTGAGAGTGG - Intronic
998471507 5:142387253-142387275 ATGAAGAAGTGAGCTGACAGTGG + Intergenic
998660569 5:144232407-144232429 GTGAAGAAATGGACTCAGAGTGG + Intronic
999973719 5:156890252-156890274 GTGCAGAGATGGGCTGAGAGGGG - Intergenic
1000937466 5:167320359-167320381 AAGAAGAAATGGGCTTATTCAGG + Intronic
1001100211 5:168808059-168808081 CTGAAAAAATGGCCTCATAGTGG + Intronic
1001149953 5:169218629-169218651 ATGAAGAAATGGAGTTTTAGGGG - Intronic
1001165388 5:169361033-169361055 ATGAAGGAATGGGTTCAGAGAGG - Intergenic
1001594673 5:172890639-172890661 ATGAGAAAATGAGCTGAGAGAGG + Intronic
1002272757 5:178083554-178083576 ATGTAGAAAAGGGCTGATAAGGG + Intergenic
1003029527 6:2589713-2589735 AGGCAGGAATGGGCTGCTAGGGG + Intergenic
1004278056 6:14255506-14255528 ATGAAGAAACGGGCCCAGAGAGG - Intergenic
1005397336 6:25396832-25396854 ATGCGGAAATGGGCTCAGAGAGG + Intronic
1007096649 6:39217459-39217481 AAGAAGAGATGAGCTGAAAGGGG - Intronic
1009798427 6:68502456-68502478 AGGCAGAAATGGGTTGCTAGGGG - Intergenic
1012455097 6:99394659-99394681 ACGAAGTAATGGCCTGATTGAGG - Intergenic
1012506913 6:99957527-99957549 TTGAAGAAAAGTGGTGATAGTGG - Intronic
1012627289 6:101419671-101419693 AGGAAGAAACAGGCTGAGAGAGG + Intronic
1013425620 6:110009995-110010017 AGGAAGAAATAGGCTCAGAGAGG + Intergenic
1016597410 6:145816893-145816915 AGGAAGAATTGTGTTGATAGGGG - Intergenic
1016618684 6:146082032-146082054 ATCAAGAAATGGGTAGATGGGGG + Intronic
1017026911 6:150189328-150189350 ATTAAGAAATGGGGTGTGAGGGG - Intronic
1017798419 6:157869230-157869252 GTAAAGAAATGGGCTGAAGGTGG - Intronic
1018425804 6:163679400-163679422 ATGAAGAGTTGGGCAGAGAGAGG + Intergenic
1021036558 7:15807339-15807361 ATGAAGAAATGGGATTATTGTGG + Intergenic
1022802078 7:33786326-33786348 ATGAAGTAAGGGGCAGAGAGTGG + Intergenic
1023484193 7:40666537-40666559 AGGAAGTAGTGGGCGGATAGTGG + Intronic
1026431382 7:70350855-70350877 AGGAGGAAATGGGCAGATATAGG - Intronic
1027362825 7:77427245-77427267 ATGAAGAAATAGGCTGGGCGCGG + Intergenic
1028917194 7:96272176-96272198 ATGAATAAATAGGCTGAGCGTGG - Intronic
1030682177 7:112445432-112445454 ATGAAGAAATGAGCTTAGAGAGG - Intronic
1031304495 7:120109616-120109638 ATGTACAAATGGACTGCTAGTGG - Intergenic
1031761338 7:125716442-125716464 AGGCAGGAATGGGCTGCTAGGGG + Intergenic
1032754600 7:134877002-134877024 TTGATGAAATGGGCTGAGAGAGG - Intronic
1037026328 8:14042786-14042808 ATAAAGCAATGGGCAGATGGAGG + Intergenic
1037341041 8:17845450-17845472 ATGAAGAAACAGTCAGATAGAGG - Intergenic
1038564788 8:28610677-28610699 ATGAAGAAATGGGCTCAGGTTGG + Intronic
1038670255 8:29577370-29577392 ATGAACAAATGGTAGGATAGAGG - Intergenic
1039378849 8:37065887-37065909 AGGAAGAAATAGGGTGATACTGG + Intergenic
1041084866 8:54247556-54247578 ATTAAAAAATGGGCAGAGAGAGG + Intergenic
1041570652 8:59333552-59333574 AGGCAGGAATGGGCTGCTAGGGG + Intergenic
1041610493 8:59841391-59841413 TTGAAGAGATGGGCTAATATAGG - Intergenic
1041833415 8:62182621-62182643 ATGTAGAAATATGCTGAAAGAGG - Intergenic
1042086966 8:65120183-65120205 ATGCAGGAATGGGCTGCTTGGGG - Intergenic
1042442580 8:68845410-68845432 CTGAAACAATGGGCTTATAGGGG - Intergenic
1043536571 8:81211565-81211587 GTGAGGAAATGGGCTTAGAGAGG - Intergenic
1045092959 8:98766058-98766080 GTGAAGAAATGGAGTGATAAGGG - Intronic
1046676133 8:117110637-117110659 ATCAAGGAATGGGCTGAGAAGGG + Intronic
1047853542 8:128884790-128884812 GTTAAGAAATGGGCTGAGAGAGG - Intergenic
1048123192 8:131604758-131604780 AAGAACACATGGGCAGATAGAGG - Intergenic
1048308815 8:133302499-133302521 AGGAAGGAATGTGCTGACAGAGG - Intergenic
1048523224 8:135176836-135176858 ATGAATAAATGGATTGAGAGAGG - Intergenic
1055809382 9:80134424-80134446 ATACAGAAATAGGCTGATTGAGG + Intergenic
1056173476 9:84011027-84011049 ATGGAGAAATGGGCAGTTATAGG + Intergenic
1056562215 9:87740935-87740957 ATGAACTAATGGACAGATAGAGG + Intergenic
1057623559 9:96657379-96657401 GTGAGGAATTGGGCTGCTAGTGG - Intergenic
1060060727 9:120457149-120457171 ATGAAGAAATGGGCTCATAAAGG + Intronic
1060629816 9:125145665-125145687 ATGAGGAAATAGGCTTAGAGAGG - Intergenic
1060920511 9:127417500-127417522 ATGAAGAAACAGGCCGAGAGGGG - Intergenic
1061006969 9:127933808-127933830 ATCAAGAAAGCGGCTGACAGTGG + Intergenic
1061703441 9:132433836-132433858 ATGAATAAATAGGTTGGTAGAGG - Intronic
1188274696 X:28185293-28185315 ATGAAGAAATGAACTGATGAAGG - Intergenic
1188595905 X:31900115-31900137 AAGAAGAAATGGGCTTAAAGTGG - Intronic
1188675180 X:32930707-32930729 ATGAAGAATTGGGGTTATGGAGG - Intronic
1189851907 X:45186220-45186242 AGGAGAAAATGGGCTGAGAGGGG + Intronic
1190393096 X:49952171-49952193 ATAAAGAAAGGGGCAGAAAGAGG + Intronic
1190728858 X:53211287-53211309 ATAAGGAAATGGGCTCACAGAGG + Intronic
1193258214 X:79375399-79375421 AAAAAGACAGGGGCTGATAGAGG - Intergenic
1194178615 X:90685317-90685339 ATGAAGAAATGGGGAGATGTGGG - Intergenic
1194423922 X:93713480-93713502 ATGAAGAAATTGTGTCATAGAGG - Intergenic
1195405076 X:104503776-104503798 ATAAAGAAATAGGCTAATAAGGG - Intergenic
1195724871 X:107904157-107904179 AAGAAGAAATGAGATTATAGGGG + Intronic
1196027462 X:111055947-111055969 AAGAAGAAAGGGGCAGAAAGAGG - Intronic
1196122844 X:112068944-112068966 AGAAAGAAATGGGCTCAGAGAGG + Intronic
1196313868 X:114199821-114199843 ATGAAGAGATGGGAATATAGAGG + Intergenic
1196402636 X:115332284-115332306 ATGAAGAAACAAGCTTATAGAGG - Intergenic
1197066317 X:122237709-122237731 AGGAAGGAATGGCCTGCTAGGGG + Intergenic
1197298080 X:124743990-124744012 AGGAAGAAATGGGCTGGGGGAGG - Intronic
1199802855 X:151268566-151268588 ATGAAGAGAGGGGCTGAGAATGG + Intergenic
1199900776 X:152169880-152169902 ATGAAGAGATGAGGAGATAGGGG - Intronic
1200525279 Y:4267480-4267502 ATGAAGAAATGGGGAGATGTGGG - Intergenic