ID: 955971984

View in Genome Browser
Species Human (GRCh38)
Location 3:64445410-64445432
Sequence CCTCCCGGCCGCGGCGCGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955971984_955971996 4 Left 955971984 3:64445410-64445432 CCGTCCGCGCCGCGGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 164
Right 955971996 3:64445437-64445459 GTAGCCTGGGCGGGCACCCTCGG 0: 1
1: 0
2: 1
3: 7
4: 112
955971984_955971992 -9 Left 955971984 3:64445410-64445432 CCGTCCGCGCCGCGGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 164
Right 955971992 3:64445424-64445446 GCCGGGAGGGCGGGTAGCCTGGG 0: 1
1: 0
2: 3
3: 23
4: 195
955971984_955971994 -6 Left 955971984 3:64445410-64445432 CCGTCCGCGCCGCGGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 164
Right 955971994 3:64445427-64445449 GGGAGGGCGGGTAGCCTGGGCGG 0: 1
1: 0
2: 2
3: 42
4: 514
955971984_955971995 -5 Left 955971984 3:64445410-64445432 CCGTCCGCGCCGCGGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 164
Right 955971995 3:64445428-64445450 GGAGGGCGGGTAGCCTGGGCGGG 0: 1
1: 1
2: 3
3: 47
4: 470
955971984_955971999 14 Left 955971984 3:64445410-64445432 CCGTCCGCGCCGCGGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 164
Right 955971999 3:64445447-64445469 CGGGCACCCTCGGCGGCCGCTGG 0: 1
1: 0
2: 2
3: 11
4: 175
955971984_955971991 -10 Left 955971984 3:64445410-64445432 CCGTCCGCGCCGCGGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 164
Right 955971991 3:64445423-64445445 GGCCGGGAGGGCGGGTAGCCTGG 0: 1
1: 0
2: 4
3: 44
4: 402
955971984_955972000 19 Left 955971984 3:64445410-64445432 CCGTCCGCGCCGCGGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 164
Right 955972000 3:64445452-64445474 ACCCTCGGCGGCCGCTGGCCTGG 0: 1
1: 2
2: 289
3: 622
4: 470
955971984_955971997 7 Left 955971984 3:64445410-64445432 CCGTCCGCGCCGCGGCCGGGAGG 0: 1
1: 0
2: 1
3: 22
4: 164
Right 955971997 3:64445440-64445462 GCCTGGGCGGGCACCCTCGGCGG 0: 1
1: 0
2: 1
3: 20
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955971984 Original CRISPR CCTCCCGGCCGCGGCGCGGA CGG (reversed) Intronic