ID: 955974023

View in Genome Browser
Species Human (GRCh38)
Location 3:64463697-64463719
Sequence CAAAATTGAAGGATTTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955974023_955974033 19 Left 955974023 3:64463697-64463719 CCCTCTTAAATCCTTCAATTTTG No data
Right 955974033 3:64463739-64463761 CCTAGTGGCAGAACCAAATGTGG No data
955974023_955974028 4 Left 955974023 3:64463697-64463719 CCCTCTTAAATCCTTCAATTTTG No data
Right 955974028 3:64463724-64463746 CTCCCTCTGGTGCCTCCTAGTGG No data
955974023_955974034 29 Left 955974023 3:64463697-64463719 CCCTCTTAAATCCTTCAATTTTG No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974023_955974026 -9 Left 955974023 3:64463697-64463719 CCCTCTTAAATCCTTCAATTTTG No data
Right 955974026 3:64463711-64463733 TCAATTTTGCCTTCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955974023 Original CRISPR CAAAATTGAAGGATTTAAGA GGG (reversed) Intergenic
No off target data available for this crispr