ID: 955974024

View in Genome Browser
Species Human (GRCh38)
Location 3:64463698-64463720
Sequence GCAAAATTGAAGGATTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955974024_955974026 -10 Left 955974024 3:64463698-64463720 CCTCTTAAATCCTTCAATTTTGC No data
Right 955974026 3:64463711-64463733 TCAATTTTGCCTTCTCCCTCTGG No data
955974024_955974033 18 Left 955974024 3:64463698-64463720 CCTCTTAAATCCTTCAATTTTGC No data
Right 955974033 3:64463739-64463761 CCTAGTGGCAGAACCAAATGTGG No data
955974024_955974028 3 Left 955974024 3:64463698-64463720 CCTCTTAAATCCTTCAATTTTGC No data
Right 955974028 3:64463724-64463746 CTCCCTCTGGTGCCTCCTAGTGG No data
955974024_955974034 28 Left 955974024 3:64463698-64463720 CCTCTTAAATCCTTCAATTTTGC No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955974024 Original CRISPR GCAAAATTGAAGGATTTAAG AGG (reversed) Intergenic
No off target data available for this crispr