ID: 955974025

View in Genome Browser
Species Human (GRCh38)
Location 3:64463708-64463730
Sequence GAGGGAGAAGGCAAAATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955974025_955974036 22 Left 955974025 3:64463708-64463730 CCTTCAATTTTGCCTTCTCCCTC No data
Right 955974036 3:64463753-64463775 CAAATGTGGCACCAGCTGGTCGG No data
955974025_955974037 23 Left 955974025 3:64463708-64463730 CCTTCAATTTTGCCTTCTCCCTC No data
Right 955974037 3:64463754-64463776 AAATGTGGCACCAGCTGGTCGGG No data
955974025_955974034 18 Left 955974025 3:64463708-64463730 CCTTCAATTTTGCCTTCTCCCTC No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974025_955974028 -7 Left 955974025 3:64463708-64463730 CCTTCAATTTTGCCTTCTCCCTC No data
Right 955974028 3:64463724-64463746 CTCCCTCTGGTGCCTCCTAGTGG No data
955974025_955974033 8 Left 955974025 3:64463708-64463730 CCTTCAATTTTGCCTTCTCCCTC No data
Right 955974033 3:64463739-64463761 CCTAGTGGCAGAACCAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955974025 Original CRISPR GAGGGAGAAGGCAAAATTGA AGG (reversed) Intergenic
No off target data available for this crispr