ID: 955974027

View in Genome Browser
Species Human (GRCh38)
Location 3:64463720-64463742
Sequence TAGGAGGCACCAGAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955974027_955974038 19 Left 955974027 3:64463720-64463742 CCTTCTCCCTCTGGTGCCTCCTA No data
Right 955974038 3:64463762-64463784 CACCAGCTGGTCGGGAGAAATGG No data
955974027_955974037 11 Left 955974027 3:64463720-64463742 CCTTCTCCCTCTGGTGCCTCCTA No data
Right 955974037 3:64463754-64463776 AAATGTGGCACCAGCTGGTCGGG No data
955974027_955974033 -4 Left 955974027 3:64463720-64463742 CCTTCTCCCTCTGGTGCCTCCTA No data
Right 955974033 3:64463739-64463761 CCTAGTGGCAGAACCAAATGTGG No data
955974027_955974034 6 Left 955974027 3:64463720-64463742 CCTTCTCCCTCTGGTGCCTCCTA No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974027_955974036 10 Left 955974027 3:64463720-64463742 CCTTCTCCCTCTGGTGCCTCCTA No data
Right 955974036 3:64463753-64463775 CAAATGTGGCACCAGCTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955974027 Original CRISPR TAGGAGGCACCAGAGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr