ID: 955974029

View in Genome Browser
Species Human (GRCh38)
Location 3:64463726-64463748
Sequence TGCCACTAGGAGGCACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955974029_955974036 4 Left 955974029 3:64463726-64463748 CCCTCTGGTGCCTCCTAGTGGCA No data
Right 955974036 3:64463753-64463775 CAAATGTGGCACCAGCTGGTCGG No data
955974029_955974033 -10 Left 955974029 3:64463726-64463748 CCCTCTGGTGCCTCCTAGTGGCA No data
Right 955974033 3:64463739-64463761 CCTAGTGGCAGAACCAAATGTGG No data
955974029_955974037 5 Left 955974029 3:64463726-64463748 CCCTCTGGTGCCTCCTAGTGGCA No data
Right 955974037 3:64463754-64463776 AAATGTGGCACCAGCTGGTCGGG No data
955974029_955974034 0 Left 955974029 3:64463726-64463748 CCCTCTGGTGCCTCCTAGTGGCA No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974029_955974038 13 Left 955974029 3:64463726-64463748 CCCTCTGGTGCCTCCTAGTGGCA No data
Right 955974038 3:64463762-64463784 CACCAGCTGGTCGGGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955974029 Original CRISPR TGCCACTAGGAGGCACCAGA GGG (reversed) Intergenic
No off target data available for this crispr