ID: 955974031

View in Genome Browser
Species Human (GRCh38)
Location 3:64463736-64463758
Sequence CATTTGGTTCTGCCACTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955974031_955974036 -6 Left 955974031 3:64463736-64463758 CCTCCTAGTGGCAGAACCAAATG No data
Right 955974036 3:64463753-64463775 CAAATGTGGCACCAGCTGGTCGG No data
955974031_955974038 3 Left 955974031 3:64463736-64463758 CCTCCTAGTGGCAGAACCAAATG No data
Right 955974038 3:64463762-64463784 CACCAGCTGGTCGGGAGAAATGG No data
955974031_955974034 -10 Left 955974031 3:64463736-64463758 CCTCCTAGTGGCAGAACCAAATG No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974031_955974037 -5 Left 955974031 3:64463736-64463758 CCTCCTAGTGGCAGAACCAAATG No data
Right 955974037 3:64463754-64463776 AAATGTGGCACCAGCTGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955974031 Original CRISPR CATTTGGTTCTGCCACTAGG AGG (reversed) Intergenic
No off target data available for this crispr