ID: 955974034

View in Genome Browser
Species Human (GRCh38)
Location 3:64463749-64463771
Sequence GAACCAAATGTGGCACCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955974025_955974034 18 Left 955974025 3:64463708-64463730 CCTTCAATTTTGCCTTCTCCCTC No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974030_955974034 -1 Left 955974030 3:64463727-64463749 CCTCTGGTGCCTCCTAGTGGCAG No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974031_955974034 -10 Left 955974031 3:64463736-64463758 CCTCCTAGTGGCAGAACCAAATG No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974024_955974034 28 Left 955974024 3:64463698-64463720 CCTCTTAAATCCTTCAATTTTGC No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974023_955974034 29 Left 955974023 3:64463697-64463719 CCCTCTTAAATCCTTCAATTTTG No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974029_955974034 0 Left 955974029 3:64463726-64463748 CCCTCTGGTGCCTCCTAGTGGCA No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data
955974027_955974034 6 Left 955974027 3:64463720-64463742 CCTTCTCCCTCTGGTGCCTCCTA No data
Right 955974034 3:64463749-64463771 GAACCAAATGTGGCACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955974034 Original CRISPR GAACCAAATGTGGCACCAGC TGG Intergenic
No off target data available for this crispr