ID: 955979844

View in Genome Browser
Species Human (GRCh38)
Location 3:64513869-64513891
Sequence CTGTAGGAGTAGTGGGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955979844_955979853 30 Left 955979844 3:64513869-64513891 CCATTTCCCCACTACTCCTACAG 0: 1
1: 0
2: 0
3: 34
4: 293
Right 955979853 3:64513922-64513944 TAAGTAAAATTTGTTAGGTAAGG 0: 1
1: 0
2: 3
3: 53
4: 519
955979844_955979852 25 Left 955979844 3:64513869-64513891 CCATTTCCCCACTACTCCTACAG 0: 1
1: 0
2: 0
3: 34
4: 293
Right 955979852 3:64513917-64513939 AGATATAAGTAAAATTTGTTAGG 0: 1
1: 0
2: 2
3: 63
4: 521
955979844_955979851 2 Left 955979844 3:64513869-64513891 CCATTTCCCCACTACTCCTACAG 0: 1
1: 0
2: 0
3: 34
4: 293
Right 955979851 3:64513894-64513916 ACATGACTGAATTCTGGCTAAGG 0: 1
1: 0
2: 3
3: 23
4: 203
955979844_955979849 -4 Left 955979844 3:64513869-64513891 CCATTTCCCCACTACTCCTACAG 0: 1
1: 0
2: 0
3: 34
4: 293
Right 955979849 3:64513888-64513910 ACAGCCACATGACTGAATTCTGG 0: 1
1: 0
2: 3
3: 26
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955979844 Original CRISPR CTGTAGGAGTAGTGGGGAAA TGG (reversed) Intergenic
900512208 1:3066165-3066187 ATGTAGGCCCAGTGGGGAAAAGG - Intergenic
900623227 1:3596726-3596748 CTGTAGGAGCAGGGTGGAGACGG - Intronic
900991139 1:6099002-6099024 GTGTAGGGGGAGAGGGGAAAGGG + Exonic
901859446 1:12064587-12064609 CTGTAGGATTAAAGGGGAACTGG - Intronic
905473735 1:38211501-38211523 CTGTAGGGGCGGTGGGGAACAGG - Intergenic
906226673 1:44128513-44128535 CTGGAGGAGAGATGGGGAAAAGG - Intronic
906609652 1:47192547-47192569 CTTTGGGAGTGGTGGGGGAAGGG + Intergenic
906742246 1:48193746-48193768 CTAGAGAGGTAGTGGGGAAAAGG + Intergenic
909178689 1:72392420-72392442 CTGCAGGAAAAATGGGGAAAAGG + Intergenic
909637807 1:77836746-77836768 CTGTATGACAAGTGGGGATATGG + Intronic
910368839 1:86494585-86494607 ATGTAGGAATTGTGGGGAAATGG - Intronic
911091988 1:94024572-94024594 GTGGAGGAGTATAGGGGAAAAGG - Intronic
912459180 1:109819790-109819812 TTGTAGGAGAAGTGGGCTAACGG - Intergenic
912609120 1:111025261-111025283 CTGCAGGAGGAGTGGGGGAGGGG - Intergenic
912728370 1:112079139-112079161 CTCTAGGAGTAGTGTTGGAAAGG + Intergenic
913251970 1:116919234-116919256 CCCTAGGCGTTGTGGGGAAAAGG + Intronic
915503241 1:156334974-156334996 ATGTTGGAGTAATAGGGAAAAGG + Intronic
916784743 1:168078357-168078379 CTGGAGGACTAGTGGGGTGAAGG + Intergenic
917274298 1:173314937-173314959 TGGTAGGAGAAGTGGGGCAAGGG + Intergenic
917820233 1:178755334-178755356 CAGCAGGAGTAGTGAGGGAAAGG - Intronic
918196439 1:182226654-182226676 CTGGAGAGGTTGTGGGGAAAGGG - Intergenic
920959618 1:210652694-210652716 CTGTAAGAAGAATGGGGAAAGGG + Intronic
921412863 1:214854699-214854721 CTGTGGGAGAAATGTGGAAATGG - Intergenic
921512546 1:216050186-216050208 ATAATGGAGTAGTGGGGAAATGG + Intronic
1063985035 10:11493403-11493425 CAGTAGGAGAAATGGGGGAATGG - Intronic
1064704850 10:18061017-18061039 CTGTAAGAGTAGTGGGGAGGAGG + Intergenic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1068045895 10:51885812-51885834 CTTTGGGAGTAGCGGGGGAAAGG - Intronic
1071679171 10:87687184-87687206 CTGTGGGGATAGTGGTGAAAGGG - Intronic
1071746466 10:88425314-88425336 GGGCAGGGGTAGTGGGGAAAAGG - Intronic
1072107407 10:92287877-92287899 CTGAAGGAGTTGGGGAGAAATGG - Intronic
1073115637 10:101089999-101090021 CTGGAGGAGGACTGGGGACATGG + Exonic
1073831483 10:107388618-107388640 CTATAGGAGAAGTTGGAAAAGGG - Intergenic
1076050617 10:127330299-127330321 CTGCTAGTGTAGTGGGGAAATGG + Intronic
1076105835 10:127823031-127823053 CTGTAGGAGAAGTAAGCAAATGG + Intergenic
1077304910 11:1864685-1864707 CTGAAGTAGGAGAGGGGAAAGGG + Intronic
1080736356 11:35019007-35019029 ATGTAGGAGCAGGGGGGATACGG - Intronic
1081059172 11:38451296-38451318 CTATAAGATTAGTGGGGAAATGG + Intergenic
1081770227 11:45645794-45645816 CTGAGGGAGAAGTGGTGAAAAGG - Intergenic
1083946790 11:65928078-65928100 CTCCAGGGGTAGTGGGGAGAGGG + Intergenic
1085336537 11:75701014-75701036 ATGTTGGAGTGCTGGGGAAATGG + Intergenic
1085683926 11:78604379-78604401 CTGCAGGAGTAATTGGGAATGGG + Intergenic
1085703899 11:78769009-78769031 CTTTAGGAAATGTGGGGAAAGGG - Intronic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1087775344 11:102251727-102251749 CTGAAGGATGAGTGGGGAATTGG - Intergenic
1087807589 11:102571796-102571818 GTGAAAGAGTAGTGGTGAAATGG - Intergenic
1087933449 11:104004184-104004206 CTGTAGAAGGGGTGGGGAGAGGG + Intronic
1088006930 11:104952610-104952632 CTGTATGTGTAGTGGGGATTAGG - Intronic
1088702332 11:112424559-112424581 CTGAAAGAGAAGTGGGAAAAAGG + Intergenic
1088733910 11:112709553-112709575 TGGTAGGAGTAGCGGGGCAATGG - Intergenic
1088763785 11:112957563-112957585 TTGAAGGAGTAGTGGGATAATGG - Intergenic
1089205488 11:116758269-116758291 CTGTATGCCCAGTGGGGAAAAGG - Exonic
1089540203 11:119185373-119185395 CTGTGGAAGCAGTGGGGTAATGG - Intergenic
1090576676 11:128112603-128112625 CTGGAGAAGATGTGGGGAAATGG + Intergenic
1090695355 11:129235699-129235721 CTCGGGGAGTAGTGGGGAAGGGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091477780 12:793914-793936 CTGGAAGAGTTGAGGGGAAATGG - Intronic
1092198119 12:6562375-6562397 CTATAGGAGTTGTGGGGTATGGG - Intronic
1093084384 12:14850790-14850812 TTGTGGGAGTAGAGGAGAAAGGG + Intronic
1096741876 12:53699551-53699573 CAGTAGGGGAAGTGGAGAAAGGG - Intergenic
1096812244 12:54178533-54178555 GTGTGGGTGCAGTGGGGAAAGGG - Intronic
1097016114 12:55988411-55988433 TTGGGGTAGTAGTGGGGAAAAGG - Intronic
1098244592 12:68503220-68503242 ATATTGGAGTAGTGGGAAAAGGG - Intergenic
1098717125 12:73843968-73843990 CTGGAGAAGTAGTGGGAATAGGG - Intergenic
1100274364 12:93058406-93058428 CTGATGGGGTAGTGGGGATAAGG + Intergenic
1100958160 12:99932408-99932430 CTGTAGAAGATGTGGAGAAAAGG - Intronic
1101180669 12:102213351-102213373 TTTTGGGGGTAGTGGGGAAAAGG + Intergenic
1101709184 12:107249083-107249105 CTCTAGCATTAGTGGGGCAAGGG - Intergenic
1102473738 12:113175226-113175248 CTGCAGAAGTTGTGGGGACAAGG - Intronic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1103500396 12:121397318-121397340 CTGAAGGAGGAGGGGGGAAATGG - Intronic
1106435505 13:29720208-29720230 CTGCAGGAGGAGGGAGGAAAAGG + Intergenic
1107976371 13:45692566-45692588 CTGTCGGGGTAGGGGGGAATTGG - Intergenic
1109039899 13:57319316-57319338 CTGGAGGGGTATGGGGGAAAGGG + Intergenic
1109863723 13:68233950-68233972 CTGGGAGGGTAGTGGGGAAATGG + Intergenic
1109935291 13:69275382-69275404 TTTTAGCAGTAGTGGGTAAATGG + Intergenic
1110868056 13:80420138-80420160 ATGTGGGAGAAGTGGGGAGATGG - Intergenic
1110950471 13:81482884-81482906 CTGGCGAAGTTGTGGGGAAAGGG + Intergenic
1111975207 13:94959765-94959787 CTTGAGGGGTAATGGGGAAAAGG - Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113966257 13:114155420-114155442 CTGTGGGAGCAGTGGGGTATGGG + Intergenic
1114556037 14:23562860-23562882 GGGTTGGAGGAGTGGGGAAAGGG + Intronic
1114799000 14:25750372-25750394 AGGTAGGAGTAGTGGAGAATGGG + Intergenic
1116181618 14:41543032-41543054 CTGTTGAAGTAGTGGGCCAAAGG + Intergenic
1117243527 14:53860316-53860338 CTGTAGGAAAAGTGGGCATAGGG + Intergenic
1118009447 14:61594468-61594490 ATGTAGTAGTTGTGGGGAGATGG + Intronic
1120780431 14:88481403-88481425 CTGTGGCAGCAGTGAGGAAAGGG - Intronic
1121823523 14:96991275-96991297 CTGTAGGAGTCTTGGGGCAGTGG + Intergenic
1123480355 15:20625388-20625410 CTGGAGGAGAAGCAGGGAAAGGG - Intergenic
1123637653 15:22374977-22374999 CTGGAGGAGAAGCAGGGAAAGGG + Intergenic
1124077528 15:26460575-26460597 GTGTAGGGGTAGTGGGCAGATGG - Intergenic
1124393152 15:29278065-29278087 CTGTAGGAGTCCTGGGGAGCTGG + Intronic
1124468209 15:29959495-29959517 CAGTAGTCGCAGTGGGGAAATGG - Intronic
1125255302 15:37756663-37756685 CTGTTTCAGTGGTGGGGAAATGG + Intergenic
1125607761 15:40951689-40951711 CTGAAGGAGTATTGGGTCAAAGG + Intergenic
1126340983 15:47641091-47641113 CGGAAGCAGCAGTGGGGAAATGG - Intronic
1126894905 15:53247659-53247681 CTGTTGGGGGAGTGAGGAAAAGG + Intergenic
1127133228 15:55890353-55890375 CTGAAGGAGGGGTGGGGAAATGG - Intronic
1129556222 15:76512587-76512609 CTGCAGAAGTGGAGGGGAAAAGG + Intronic
1130915579 15:88302131-88302153 GTGCAGGGGAAGTGGGGAAAGGG - Intergenic
1131454837 15:92575486-92575508 GTGTAGGAGAAATGGAGAAATGG + Intergenic
1131460788 15:92616276-92616298 CTGTAGGAGAAGAGGGGTAGGGG - Intergenic
1131664404 15:94555229-94555251 CTCTAAGAGTAGTGAGTAAAGGG + Intergenic
1133609743 16:7422345-7422367 TTGTTAGAGTACTGGGGAAATGG + Intronic
1133741658 16:8656377-8656399 CTGTGGGGGAAGTGGGGAAAAGG - Intergenic
1136906898 16:34102139-34102161 TTTGAGGAGTATTGGGGAAAAGG - Intergenic
1138082174 16:54100890-54100912 CTGTAGCAGTAAAGGGGAAAAGG + Intronic
1139466083 16:67154960-67154982 CTGCAGAGGGAGTGGGGAAACGG + Intronic
1139788906 16:69416367-69416389 CTGAAAGAGTTGGGGGGAAATGG - Intergenic
1140954542 16:79849800-79849822 CTGTAGGAGGAGTGGGGTCAAGG - Intergenic
1143380934 17:6495990-6496012 CAGTAGGAGAACTGGGGCAAGGG + Intronic
1144589540 17:16512593-16512615 ATGTAGGAGTGGTGGGGGAGGGG - Intergenic
1145838909 17:27977431-27977453 CAGTTGGGGTAGTGGGGACAGGG + Intergenic
1147111592 17:38266248-38266270 CTGCAGAAGTAGTTGTGAAAAGG - Intergenic
1147512293 17:41081474-41081496 CTGCAGGAGTTGTGGGGCAATGG + Intergenic
1147514465 17:41102645-41102667 CTGCAGGAGTTGTGGGGCAATGG + Intronic
1147845757 17:43402878-43402900 CTGCCAGAGTAGTGGGGAGAGGG + Intergenic
1147977839 17:44258218-44258240 CTGGAGGAGGTGAGGGGAAAGGG + Intronic
1148131864 17:45266971-45266993 CTGTGCAAGTAGTGGGTAAAGGG - Intronic
1148417982 17:47522553-47522575 CTGCAGAAGTAGTTGTGAAAAGG + Intergenic
1149000449 17:51752088-51752110 CTATGGGAAGAGTGGGGAAAAGG - Intronic
1150666062 17:67139741-67139763 CTGTAAGAGCTGTGGGGGAAAGG - Intronic
1150885928 17:69085610-69085632 CTGGAGAGGTAGTGAGGAAATGG - Exonic
1151133306 17:71920957-71920979 CAGGAGGAGAAGTGGGGAAGAGG + Intergenic
1151923167 17:77173225-77173247 CTTTAGAAGTGGTGGGGAAAGGG + Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152451228 17:80381717-80381739 CTCTAGCAGAAGTGAGGAAAGGG + Exonic
1152618393 17:81348432-81348454 CTGGAGGAGTCCTGGGGAGATGG + Intergenic
1155398182 18:25408500-25408522 CTGAAGGAGATGTGGGGGAAAGG - Intergenic
1156267699 18:35503514-35503536 CCTGAGGAGTAGGGGGGAAAAGG - Intergenic
1158749202 18:60239395-60239417 CTGTTGAAGTTGTGGAGAAAAGG - Intergenic
1159146307 18:64458209-64458231 CTGTTGGGGGAGGGGGGAAAGGG + Intergenic
1159477960 18:68948701-68948723 TGCTGGGAGTAGTGGGGAAATGG - Intronic
1159578491 18:70207740-70207762 CTGTAGATGCAGTGGGGTAAGGG + Intergenic
1162315791 19:9937106-9937128 CGGGAGGACTGGTGGGGAAATGG - Intergenic
1165578931 19:36845596-36845618 CTCTAGCAGTATTGGGGAAATGG + Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1166500541 19:43337812-43337834 CTGAAGGAGGATTGGGGTAAAGG + Intergenic
926187911 2:10706122-10706144 GTGTAGGGGTAGTGGGTATATGG - Intergenic
927226599 2:20771955-20771977 TTGCAGGAATAGTGGTGAAAAGG - Intronic
929656116 2:43733404-43733426 CTGGAGGAGTGGAGGAGAAAGGG - Intronic
931713272 2:65007975-65007997 CAGGAGGTGTAGGGGGGAAAGGG - Intronic
931985034 2:67733449-67733471 CTGGAGGACTAGTGGGGAAGAGG - Intergenic
933725020 2:85421764-85421786 CTGCAGGAGGAGGGAGGAAAGGG + Intronic
936503091 2:113081987-113082009 GGGTGGGAGTAGTGGAGAAAGGG + Intergenic
937090422 2:119202564-119202586 CTGTAGGAGCACTGGAGAAAGGG - Intergenic
937826808 2:126375339-126375361 CTGTCGAAGTTGTGGAGAAAGGG - Intergenic
938166243 2:129029476-129029498 CTTTAGGTGTGGTAGGGAAAGGG - Intergenic
938302519 2:130227398-130227420 CTTTAGGAGGAGTGGGGAACAGG - Intergenic
938454164 2:131446854-131446876 CTTTAGGAGGAGTGGGGAACAGG + Intergenic
941167482 2:162098175-162098197 CTCTAGGAGGAGGGGGGTAAAGG - Intergenic
942192925 2:173488713-173488735 CTATAGGAATAGTGTGTAAAAGG - Intergenic
943552748 2:189360766-189360788 CTGTTGGAGGGGTGGGGGAAGGG - Intergenic
944121810 2:196248542-196248564 CTGTAGGAAAGGTGGGGAAAGGG + Intronic
944558535 2:200911859-200911881 CTGAATGAGAAGTGTGGAAATGG - Intronic
944651069 2:201830810-201830832 TTGAAGTGGTAGTGGGGAAAAGG + Intronic
944960076 2:204862716-204862738 CTGCAACAGTAGAGGGGAAAAGG - Intronic
945225977 2:207530853-207530875 GTGTAGGAGCGGGGGGGAAAGGG - Intronic
945536865 2:211028031-211028053 GTGTTGGAGTAGTGGGTATATGG - Intergenic
948395785 2:237644018-237644040 CTGTAGGAGTAAACAGGAAAAGG - Intronic
1169607561 20:7339819-7339841 ATGTACCAGTAGTGGGGAAGAGG - Intergenic
1169648565 20:7841879-7841901 CTGTATGAGTAGGAGAGAAATGG + Intergenic
1172060269 20:32182576-32182598 CTGTAGTAGGAGTCGGGAATGGG + Intergenic
1174213737 20:48900193-48900215 CTGCAGGAATAATGGGAAAAGGG - Intergenic
1175682992 20:61004930-61004952 CTGTAGCAGTAGTAGAGTAATGG - Intergenic
1176064223 20:63186559-63186581 CTGAAGGATGAGTTGGGAAAGGG - Intergenic
1176264282 20:64200715-64200737 CTGTTTGTGAAGTGGGGAAACGG + Intronic
1178107492 21:29336503-29336525 ATGCAGGAGTATTGGGGAACGGG - Intronic
1178489808 21:33042274-33042296 CTATAGGAGCTGTGGGGAAACGG + Intergenic
1179447771 21:41445229-41445251 CTGTCGCAGGAGTGGGGAAGGGG + Intronic
1181751099 22:24989732-24989754 CTTGGGGAGTGGTGGGGAAAGGG - Intronic
1182395655 22:30034019-30034041 CTGTGGGAGGAGTCGGGGAAAGG + Intergenic
1182417943 22:30233165-30233187 CTGTGGGAGGAGTGGGGGAGGGG + Intergenic
1183070735 22:35394280-35394302 CGGTAGGAGAAGTGGTGATAGGG + Intergenic
1183163798 22:36132478-36132500 CCGTGGGAGCAGTGGGGGAAAGG - Intergenic
1184911562 22:47538639-47538661 TGGTAGGGGGAGTGGGGAAAGGG + Intergenic
950173787 3:10857267-10857289 TTGGAGGAGTGGTGTGGAAAGGG + Intronic
950297102 3:11841725-11841747 CTGCTGGAGTTGGGGGGAAAAGG - Intronic
950336179 3:12195350-12195372 CTGGAGGAGTCCTGGGGAAAGGG - Intergenic
950692251 3:14669099-14669121 CTGTAGGAGAAGCTGGGAAATGG + Intronic
951069959 3:18316035-18316057 CTGAAGAGGTAGTGGAGAAAAGG - Intronic
952028564 3:29113016-29113038 GTGTATGAGAAGTGAGGAAAAGG - Intergenic
953567133 3:44042308-44042330 CTGTTAGAGGAGAGGGGAAATGG + Intergenic
954456070 3:50600514-50600536 CAGTGGGGGTAGTGGGGGAAGGG + Intergenic
955979844 3:64513869-64513891 CTGTAGGAGTAGTGGGGAAATGG - Intergenic
956196177 3:66655394-66655416 CTGGTGGAATAGTGGGGCAAGGG + Intergenic
957389051 3:79537729-79537751 CTGTTGGGGGAGTGGGGAGAGGG + Intronic
957850152 3:85797402-85797424 CTGTTGGGGTAGTGGGGTAAGGG - Intronic
959330967 3:105004301-105004323 CAGTAGGAGGAGTGGGAGAAAGG + Intergenic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
959901327 3:111664816-111664838 CTGTACTAGAAGGGGGGAAATGG + Intronic
960015157 3:112878899-112878921 ATGGAGGAGAAGTGGGAAAATGG - Intergenic
960338638 3:116447889-116447911 CTGTTGGTGGTGTGGGGAAAGGG - Intronic
960615080 3:119589143-119589165 CTGTGGGAGGAGTGAGGAGAAGG - Exonic
960833305 3:121875180-121875202 GTTGAGGGGTAGTGGGGAAAGGG + Intronic
961134340 3:124496056-124496078 CTGGAGGAGTTTTGGGGAAGGGG + Intronic
962320712 3:134388285-134388307 CTGTAGGAGAGGTGCAGAAAAGG - Intergenic
963387282 3:144613548-144613570 TAGAAGGAGGAGTGGGGAAAGGG - Intergenic
963530100 3:146463725-146463747 CAGTAGGAGGAGTTGGTAAAAGG - Intronic
963883699 3:150555801-150555823 CTGCAGGAGTAGGGGAGAAAGGG + Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
967507606 3:190270758-190270780 CTGTCGGTGAAGTGGGGAAAGGG - Intergenic
967851906 3:194088730-194088752 CTCTAGGATTAGTGGGGAGCAGG - Intergenic
968643203 4:1725374-1725396 CTGGAGGGGTAGAGGGGAGACGG - Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969325554 4:6441935-6441957 CTGCAGGAGTAGGGCGGAGAAGG - Intronic
970402205 4:15728212-15728234 GTTTAGGAATAGTGGGGTAAAGG + Intronic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
971183092 4:24349312-24349334 CTGCAGTAGTAGTGTGGAGAGGG + Intergenic
974035076 4:56810999-56811021 CTGTATTAGTAGTCGGGAAGTGG - Intronic
976469763 4:85414653-85414675 CTGTAGATGTAGAGTGGAAATGG + Intergenic
977223785 4:94370538-94370560 CTGAAGTAGTACTAGGGAAATGG + Intergenic
977818325 4:101442225-101442247 CTGTAGGGCTAGTGGGGGAAAGG - Intronic
977875163 4:102140984-102141006 TGGTAGGAGTAGTGGGGGCAGGG + Intergenic
978007133 4:103630688-103630710 CTGGAGGAGATGTGGAGAAATGG + Intronic
978461540 4:108959491-108959513 CTTTGGTTGTAGTGGGGAAAAGG - Intronic
978812553 4:112867552-112867574 ATGAGGGAGTAGGGGGGAAAGGG - Intronic
980239250 4:130152240-130152262 CTGGAAGGGTAGTGGGGAGAAGG + Intergenic
980873636 4:138638574-138638596 CTGTGGCAGGAGTGGGGAGATGG - Intergenic
981045485 4:140261319-140261341 CTGTTGGAGTGGTGGGGTGATGG - Intronic
982260247 4:153488402-153488424 CTGTGGGAGGAGTGGGGACCGGG + Intronic
982753538 4:159191401-159191423 ATGATGGAGGAGTGGGGAAAGGG + Intronic
983526248 4:168763019-168763041 CTGTTGGGGTAGGGGGCAAAGGG + Intronic
986745318 5:10738698-10738720 TTGTGGCAGTAGTGGGAAAATGG + Intronic
987808352 5:22800455-22800477 GTGTAGGACTAGTGGGTAAACGG - Intronic
989016221 5:36938029-36938051 CTTTAGGAGCAGGGGGTAAATGG - Intronic
989431013 5:41355553-41355575 CTCCAGGAGTAGCAGGGAAAGGG - Intronic
989673073 5:43942401-43942423 CTGGAGGAGATGTGGAGAAAGGG + Intergenic
990533954 5:56701505-56701527 CTATGGGAGTAGTGGGGACTGGG - Intergenic
990935547 5:61144672-61144694 CTTGATGAGTATTGGGGAAAGGG - Intronic
990967477 5:61464737-61464759 CTTTAGGAGTGGTGGTGAAGAGG - Intronic
992080646 5:73232673-73232695 CTGGAGGAAGAGTGGGGAAGCGG - Intergenic
992136185 5:73748762-73748784 CTGTGGGAGTGGCGGGGAAATGG - Intronic
992871124 5:81006693-81006715 CAGACGGAGAAGTGGGGAAAGGG - Intronic
993881150 5:93362940-93362962 CTGGAGAAGTTGTGGAGAAAAGG + Intergenic
994473019 5:100234168-100234190 CTGGAGAAGTTGTTGGGAAAAGG - Intergenic
995078970 5:108024067-108024089 CTATAGGAGTGATGGGGACAAGG - Intronic
995511136 5:112910369-112910391 GTGTAGGCGTAGTGGGTACATGG + Intronic
997113349 5:131099584-131099606 CTGAAGGAGCAATGTGGAAATGG - Intergenic
997189307 5:131915437-131915459 TTGTAGCAGTGCTGGGGAAAGGG - Intronic
1000474105 5:161683918-161683940 CTGTTGGGGATGTGGGGAAAGGG + Intronic
1004367593 6:15024912-15024934 TTGTGGGGGTAGTGGGGACAGGG + Intergenic
1005819905 6:29589188-29589210 GTGAAGGAATAGTGGGGATATGG - Intronic
1005882582 6:30072239-30072261 CTGTAGGGGTTGTGGGGCAGAGG + Intronic
1005898456 6:30197447-30197469 GTGGAGGAGTAGTGGGGTCAGGG - Intronic
1007790809 6:44307136-44307158 CAGTAGGAGGAATGGGGAGAGGG - Intronic
1007882823 6:45186143-45186165 CTGTAGTGGTACTGGGGGAAAGG + Intronic
1008253133 6:49265100-49265122 CTGCAGGCCTAGTGGGGCAATGG - Intergenic
1009994833 6:70886558-70886580 CTGAAGGGGAAGTGGGGAGACGG - Intronic
1010507568 6:76679036-76679058 CTGTAGGGGGAGGGGGGAAGGGG + Intergenic
1011718475 6:90131103-90131125 CTGGAGGACCACTGGGGAAAAGG + Intronic
1012035933 6:94139419-94139441 CTATAGAAGTGGTGGGGAATTGG - Intergenic
1012746910 6:103102964-103102986 CTGGAGCATTAGTGGAGAAAAGG - Intergenic
1013651927 6:112203736-112203758 ATGTAGGAGTAGGGAGGAATTGG - Intronic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1015239136 6:131004646-131004668 CTGGAGGAGTGGTGGGGGTAAGG - Intronic
1015789281 6:136950345-136950367 GTGTGGGAGTAGTGGATAAATGG + Intergenic
1017708465 6:157146176-157146198 CTGTGGCAGAAGAGGGGAAAGGG - Intronic
1018002003 6:159587658-159587680 CTGAAGGAGTCGTGGGGAGAAGG - Intergenic
1018342688 6:162868283-162868305 CTCTAGTAATAGCGGGGAAAAGG - Intronic
1018384076 6:163287316-163287338 CTGTAAGAGCAGTGGGGACCAGG - Intronic
1019215613 6:170441118-170441140 CTGTTGGACTAGATGGGAAATGG - Intergenic
1020607976 7:10361459-10361481 CTGTAGGGGTTGTGGGGTAAGGG + Intergenic
1022318859 7:29269197-29269219 CTGGCAGAGTAGTGGGGAGAGGG - Intronic
1023138101 7:37073964-37073986 TTTTAGGAGAAGTAGGGAAATGG + Intronic
1026602072 7:71785338-71785360 GTGCAGGAGTAGGGAGGAAAAGG - Exonic
1026736714 7:72953649-72953671 GTGTATGAGTTGTTGGGAAAGGG - Intergenic
1026736976 7:72954926-72954948 CTGGAGAAGAAGTGGCGAAACGG - Intergenic
1027106756 7:75410137-75410159 CTGGAGAAGAAGTGGCGAAACGG + Intronic
1027107020 7:75411414-75411436 GTGTATGAGTTGTTGGGAAAGGG + Intergenic
1028242258 7:88435670-88435692 CTGCAGGAGAAGTGGAGAAAAGG - Intergenic
1031005672 7:116468167-116468189 CTGTCTGAGGAGTGAGGAAAAGG + Intronic
1031553877 7:123147877-123147899 CTTTGGGAGTAGTGGTGAGAAGG - Intronic
1031893097 7:127317966-127317988 CTGGAGGAGGAGGGGAGAAAGGG + Intergenic
1032002691 7:128275702-128275724 TTGTGGGAGGAGTGGGGAAGAGG + Intergenic
1032198989 7:129805715-129805737 ATGAAGGAGTAGTGGGGACAGGG + Intergenic
1033263538 7:139865233-139865255 CTGAAGGGTTGGTGGGGAAATGG - Intronic
1033642899 7:143279273-143279295 CTGGAGGAGCAGTGTGGGAAAGG + Intergenic
1034200204 7:149279403-149279425 CTGCAGGAGTGTTGGGGACATGG + Intronic
1036516510 8:9449396-9449418 AAGTAGTAGTAGTGGGGCAATGG + Intergenic
1036579617 8:10061896-10061918 CTGCAGCAGTGGTGGGGAAGAGG + Intronic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1036908044 8:12724384-12724406 CTGAAGAACTAGTGGGGAAGTGG - Intronic
1037888123 8:22605736-22605758 CTTTCAGAGTCGTGGGGAAAAGG - Exonic
1038278287 8:26140034-26140056 CTTTAGGAGAAGTGAGAAAATGG - Intergenic
1038829599 8:31042320-31042342 CTAGACAAGTAGTGGGGAAAGGG + Intronic
1040580888 8:48697635-48697657 CTGCAGGAATAGTGGGGATGGGG + Intergenic
1043162217 8:76859997-76860019 CTGCAGTAGGAGTTGGGAAATGG + Intronic
1046971904 8:120232414-120232436 CTGTTGGGGTTGTGGGGCAAGGG - Intronic
1047180300 8:122581387-122581409 TTGCAGGTGTAGTGGAGAAAGGG - Intergenic
1049974122 9:845697-845719 CGGGAGAAGCAGTGGGGAAAGGG - Intronic
1050398655 9:5227705-5227727 CTGTGGGGGTGGTGGGGCAAGGG + Intergenic
1052107806 9:24541721-24541743 GAGTAGCAGTAGGGGGGAAAAGG + Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052841911 9:33298895-33298917 CTGGAGTAATAGTGTGGAAAAGG + Intronic
1055078203 9:72238739-72238761 CTGGGGGAGTAGTGGGGTAAGGG + Intronic
1055104300 9:72496812-72496834 GTGTGGAAGTATTGGGGAAAGGG - Intergenic
1055248392 9:74275044-74275066 CTGTGGGAGTAGGGGTGAACTGG - Intergenic
1055836258 9:80446518-80446540 GAGTAGGAATAGTGGGTAAATGG - Intergenic
1056631067 9:88293544-88293566 CTGTAGGAATAGGGGTGAACAGG - Intergenic
1057195747 9:93114963-93114985 CTGTGGGTGTAGTGTGGAAGCGG - Intergenic
1059122494 9:111654686-111654708 CTGTTGGAGGAGTGTGGAGAAGG + Intronic
1059304527 9:113343507-113343529 ATGCAGGAGTAGTGAGGGAAGGG + Intergenic
1059575242 9:115480773-115480795 CTGTAGAAGTAATGGAGTAATGG - Intergenic
1060000359 9:119952981-119953003 CTGTAGGAGAAGGGGAGGAATGG - Intergenic
1060320814 9:122559192-122559214 ATTTAGGAGGAGTGGGGAACAGG - Intergenic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061180478 9:129022475-129022497 GTGGGGGAGTGGTGGGGAAAGGG + Intronic
1185647852 X:1627904-1627926 CTGGGGTAGTAGTGGGGATAGGG - Intronic
1187217956 X:17295398-17295420 CTGTAGGAGTTCTAGGGAAGGGG + Intergenic
1187840274 X:23479734-23479756 GAGTAGGAGTAGTGAGGAAAGGG + Intergenic
1189266781 X:39723113-39723135 CTGTAGAAGATGTGGGGAAAGGG + Intergenic
1191760925 X:64647336-64647358 CTGTTGGAGCAGTGAGGAGAGGG + Intergenic
1192699990 X:73458665-73458687 TTGTATGAGTGGTGGGGAAGTGG - Intergenic
1193609612 X:83613402-83613424 CTGGAGAAGTTGTGGAGAAAAGG - Intergenic
1194020341 X:88682576-88682598 GTGTGGGAGTAGTGGGTATATGG - Intergenic
1194365669 X:93010964-93010986 CAGTAGCAGCAGTGGGAAAATGG + Intergenic
1196807877 X:119605278-119605300 CAGTTGGAGTTGTGGGGGAAGGG - Intronic
1197643049 X:128987212-128987234 CTTTAGCAGCAGTGTGGAAATGG + Intergenic
1197780272 X:130152305-130152327 CTAGAGGTTTAGTGGGGAAAGGG + Intronic
1198684719 X:139215709-139215731 CTGTCGGTGGTGTGGGGAAAGGG - Intronic
1200254343 X:154571764-154571786 CTGGAGGAGTTGGGGGAAAACGG + Intergenic
1200263426 X:154632644-154632666 CTGGAGGAGTTGGGGGAAAACGG - Intergenic
1200616834 Y:5388599-5388621 CTGTAGGAGTTCTGGAGCAAAGG + Intronic
1201074769 Y:10178798-10178820 CTGGGGGAGAAGTGGGGACAAGG - Intergenic
1201473818 Y:14360051-14360073 CATAAAGAGTAGTGGGGAAAGGG - Intergenic
1202298485 Y:23385081-23385103 CTGGAGGAATATTGGTGAAATGG - Intergenic
1202572323 Y:26285518-26285540 CTGGAGGAATATTGGTGAAATGG + Intergenic