ID: 955982349

View in Genome Browser
Species Human (GRCh38)
Location 3:64539744-64539766
Sequence CCTAGGCAACAGGAGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955982349_955982354 -1 Left 955982349 3:64539744-64539766 CCTCTGTCCTCCTGTTGCCTAGG 0: 1
1: 0
2: 1
3: 16
4: 264
Right 955982354 3:64539766-64539788 GCAGTATTATTGCCAAAATGTGG 0: 1
1: 0
2: 1
3: 17
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955982349 Original CRISPR CCTAGGCAACAGGAGGACAG AGG (reversed) Intronic
900565262 1:3328981-3329003 CCCAGGCCAGAGGAGAACAGGGG + Intronic
901531734 1:9858004-9858026 CCTGAGCAACAGGAGGATGGAGG - Intronic
901967534 1:12880705-12880727 CCTGGGCCACAGGAGCCCAGTGG + Intronic
901975333 1:12939836-12939858 CCTGGGCCACAGGAGCCCAGTGG + Intronic
902009842 1:13261929-13261951 CCTGGGCCACAGGAGCCCAGTGG - Intronic
902235992 1:15057787-15057809 CCAGGGCAGCAGGAGGGCAGAGG + Intronic
902838972 1:19063460-19063482 CCCAGGGAACAAGAGGACATTGG - Intergenic
903169749 1:21545007-21545029 ACTGGGAAACAGTAGGACAGTGG - Intronic
903366788 1:22810316-22810338 CACAGGAAACAGGAGAACAGTGG - Intronic
904840743 1:33370370-33370392 CAGAGGCACCAGGAGGACAGAGG - Intronic
905773758 1:40654938-40654960 CCTGGGCACCAGGAGGATGGAGG - Intronic
905929465 1:41777058-41777080 CCGAGTCAACAGGAGGGCCGTGG + Intronic
907319045 1:53591303-53591325 CGCAGGCAAGAGGAGGCCAGGGG + Intronic
912895889 1:113588585-113588607 AATAGGCAAAAGGAGGACATGGG + Intronic
912951175 1:114121479-114121501 TCTAAGCAACAGGAGGACCCTGG + Intronic
913050630 1:115114109-115114131 CCCAGGAAACTGGAGGACCGAGG - Intergenic
916299556 1:163258691-163258713 CCTAGGCAACAGAGAGACACTGG - Intronic
918315685 1:183320840-183320862 TTTTGGCAACAGCAGGACAGAGG - Intronic
919470703 1:197975906-197975928 GCTAGGCAACAGGGAGACACAGG + Intergenic
922219890 1:223550419-223550441 CCCAGCCCACAGGAGGACACAGG - Intronic
922892766 1:229074291-229074313 CCCAGCCCACAGGAGGGCAGAGG + Intergenic
924769728 1:247068274-247068296 CCTAGGCTGCTGGAGTACAGTGG - Intronic
1062952387 10:1514594-1514616 CCAAGGCCATAGGAGGCCAGGGG - Intronic
1064999737 10:21327665-21327687 CAGAAGCAACAGGAGGAAAGAGG - Intergenic
1065763341 10:29003897-29003919 TCTAGGCAACTGGAGCACAATGG - Intergenic
1067770872 10:49123905-49123927 CCTAGGCTATAGGAGTGCAGTGG + Intergenic
1068647076 10:59479953-59479975 CCTAGGCAACTGGAGGATGGAGG - Intergenic
1068764364 10:60746648-60746670 ACAAGGCACCAGGAGAACAGGGG - Intergenic
1070788588 10:79176512-79176534 CCTTGGCACCAGGAGGATGGAGG - Intronic
1071370234 10:84943849-84943871 CCTTGCCAAAAGGAGCACAGTGG - Intergenic
1074585407 10:114763615-114763637 CCAAGGCAGCATGAGGTCAGGGG - Intergenic
1074933785 10:118157657-118157679 CCTAGGCAAGAGGAAGACTCAGG + Intergenic
1075196655 10:120365352-120365374 CCCAGGCAAGAGGAGTACACTGG + Intergenic
1075835373 10:125448421-125448443 CCTAGAGAACAGGAGGACGAAGG - Intergenic
1076159604 10:128233415-128233437 ACTAGGCAAAAGGAGAACATAGG - Intergenic
1078866477 11:15302575-15302597 CCTAGGCAACCTGAGGGCAGGGG - Intergenic
1079122996 11:17698452-17698474 CATGGGCAAGAGGAGGACATTGG - Intergenic
1079145128 11:17844456-17844478 CCTAGGAAAGAGGTGGTCAGAGG - Intronic
1080931606 11:36817191-36817213 ACTGGGCCACAGGAGTACAGAGG + Intergenic
1081947466 11:47010237-47010259 CCTTGGCAAAAAGAGGAAAGTGG + Intronic
1082790881 11:57346099-57346121 CCCAGGAGACAGAAGGACAGAGG - Intronic
1083177645 11:60961415-60961437 CCTAGGCTACAGCATGACAGTGG + Intergenic
1083736788 11:64686040-64686062 CCTGGGCACCAGGAGCCCAGAGG + Intronic
1083866279 11:65455247-65455269 CGTAGGCGACTTGAGGACAGAGG - Intergenic
1084276706 11:68055348-68055370 CCCAGGCAGGAGGAGTACAGTGG - Intronic
1085201340 11:74704013-74704035 GCGAGGCTGCAGGAGGACAGTGG - Intronic
1087836320 11:102878943-102878965 TCTAGGCACCAGGAATACAGTGG + Intergenic
1088753868 11:112868928-112868950 CTGAGGCCACAGGAGGAAAGAGG - Intergenic
1089314204 11:117579740-117579762 TCTAGGCACCAGGAATACAGTGG - Intronic
1090598327 11:128343108-128343130 CTTTGGCAGCAGGAGGCCAGGGG + Intergenic
1090715400 11:129426214-129426236 CCTAGGAGAGAGGAGGACAGAGG - Intronic
1091049470 11:132354385-132354407 CCTGAGTAACAGGAGGTCAGAGG + Intergenic
1091663144 12:2399324-2399346 CCCAGGCACCAAGAGGACAGGGG - Intronic
1093860491 12:24160369-24160391 CCTAGTGACCAGGAGGATAGGGG + Intergenic
1095968255 12:47883758-47883780 CTTAGGCCACTGGAAGACAGAGG - Intronic
1096048587 12:48586406-48586428 CCTAGGGAACAGGAAGAGATAGG + Intergenic
1096598047 12:52709704-52709726 CCCAGGCTGCAGGAGCACAGAGG - Intergenic
1096638661 12:52977032-52977054 CATAGCCAGCAGGAGGTCAGGGG - Intergenic
1098943498 12:76564120-76564142 CCTTGGCACCTGGTGGACAGGGG + Intergenic
1101558558 12:105833869-105833891 CCTAGGCAAGGGGAGGAGGGAGG - Intergenic
1103268202 12:119648683-119648705 GCTAGGGACCAGGAAGACAGAGG - Intergenic
1103452408 12:121038675-121038697 GCTAGGGATAAGGAGGACAGGGG + Intronic
1105989144 13:25600900-25600922 AGTAGGCATCAGGAGGACACGGG + Intronic
1106642838 13:31602215-31602237 CTAAGGCAACAGTGGGACAGGGG + Intergenic
1106782584 13:33074429-33074451 CCTGGGCTACAGGATGACAGAGG - Intergenic
1107715348 13:43194177-43194199 CCTTGGCAAGAGGAGAAAAGAGG + Intergenic
1107961204 13:45560952-45560974 CCTAGGCTACTAGAGTACAGTGG + Intronic
1108698586 13:52924789-52924811 CCCAGGCAGCAGGAATACAGTGG + Intergenic
1110616530 13:77548046-77548068 CCTAGGTCAGAGGAGGACTGAGG - Intronic
1111697055 13:91638161-91638183 CCTAGAAACCAGGTGGACAGTGG + Intronic
1111908570 13:94284174-94284196 CCCAGGCCCCAGGCGGACAGAGG - Intronic
1113065867 13:106374061-106374083 CCTAGGGCACATGGGGACAGTGG - Intergenic
1113730695 13:112639141-112639163 CCTGGGCAACTGGACGACTGTGG - Intergenic
1114076084 14:19161885-19161907 CCTAGGCACCAGGTAGACATCGG - Intergenic
1114254285 14:20988624-20988646 CCCAGGTAAAAGGAGGACTGAGG + Intergenic
1117161485 14:52994529-52994551 GCTCAGCAACAGCAGGACAGGGG - Intergenic
1118324080 14:64769728-64769750 CCTGGGGGACAGGAGGACAAGGG + Exonic
1119196060 14:72717469-72717491 CAAAGGCAACAGGAGTTCAGAGG - Intronic
1119482008 14:74963709-74963731 GCTAGGGAGCAGGAGGTCAGTGG + Intergenic
1119860729 14:77934087-77934109 TCTAGGGAACAGAAGGCCAGGGG + Intronic
1121879746 14:97489344-97489366 CCCAGGAAACAGGACCACAGAGG - Intergenic
1122795290 14:104203046-104203068 CAGAGGCCAGAGGAGGACAGGGG + Intergenic
1122846628 14:104503814-104503836 CCCAGGCTGCAGGAGGACATGGG - Intronic
1122854690 14:104554442-104554464 CTTAGGGAACAGCAGGACAGAGG - Intronic
1126172943 15:45709168-45709190 CATAGAGAACAGGAGGCCAGAGG + Intergenic
1126705831 15:51404042-51404064 CAGAGGCAACAGGGAGACAGTGG - Intronic
1126911617 15:53422879-53422901 CCTGAGCAACAGGAAGAGAGAGG - Intergenic
1128221491 15:65971834-65971856 AATAGGCAACAGGAACACAGAGG + Intronic
1128896369 15:71377384-71377406 CCTAGGAGACAGCAGGAAAGGGG + Intronic
1131846566 15:96495285-96495307 CAAAGGCAACAGGAAGCCAGGGG + Intergenic
1132160149 15:99533792-99533814 CCTGGGCAACAGAGGGAGAGAGG - Intergenic
1132629601 16:910806-910828 CCAGGCCGACAGGAGGACAGAGG + Intronic
1133107122 16:3519244-3519266 CCAGGGCAACAGTTGGACAGAGG - Intronic
1133127530 16:3656366-3656388 CCCAGGCGACAGGAGGGCGGGGG - Intronic
1133127549 16:3656422-3656444 CCCAGGCGACAGGAGGGCGGGGG - Intronic
1133127568 16:3656478-3656500 CCCAGGCGACAGGAGGGCGGGGG - Intronic
1133127587 16:3656534-3656556 CCCAGGCGACAGGAGGGCGGGGG - Intronic
1133213752 16:4278113-4278135 CCCAGGCAGGAGGAGTACAGTGG + Intergenic
1134210487 16:12272252-12272274 CCTTGGGGACAGGAGGCCAGTGG + Intronic
1134308614 16:13056195-13056217 CCAGGGCAGCAGGAGAACAGAGG + Intronic
1136383249 16:29906837-29906859 CCAAGGCAAGAGGAAGGCAGGGG + Exonic
1136569733 16:31089387-31089409 CCTGGGAAACAGGGTGACAGCGG + Intronic
1136631336 16:31490762-31490784 CTTTGGCCACAGCAGGACAGGGG - Exonic
1136922578 16:34344779-34344801 CCTAGGCACCAGGGGAACAAAGG + Intergenic
1136981995 16:35067027-35067049 CCTAGGCACCAGGGGAACAAAGG - Intergenic
1137564859 16:49526595-49526617 CCCGGGCTGCAGGAGGACAGAGG + Intronic
1137576750 16:49605046-49605068 CCTTGGCAAGAGGAGAAGAGTGG - Intronic
1138223165 16:55270275-55270297 CCTTGGCCACAGGAGGCCATCGG - Intergenic
1138413633 16:56858772-56858794 CCTCGGCAAGAGGAGGTGAGGGG - Intergenic
1139191754 16:64872002-64872024 CTTAGGACACAAGAGGACAGAGG + Intergenic
1139509301 16:67417327-67417349 CCTAGCTAAAAGGAGTACAGTGG - Intergenic
1139708864 16:68761235-68761257 CCCAGGCAGCGGGAGGGCAGAGG - Intronic
1141480715 16:84304862-84304884 GCTGGGCCACAGGAGGGCAGAGG + Intronic
1142146726 16:88495893-88495915 CTAAGGCAAGAGGAGCACAGGGG + Intronic
1143411903 17:6714020-6714042 CCTGGGACAGAGGAGGACAGTGG - Intergenic
1143432669 17:6898600-6898622 CCAGGTCATCAGGAGGACAGAGG - Intronic
1144674744 17:17154546-17154568 CCTGAGCAACAGAAGGACACAGG - Intronic
1145836856 17:27960999-27961021 CCTAAGCACCAGGAGGAGATAGG - Intergenic
1145876279 17:28320442-28320464 CCCATGCAAAAGGAGGTCAGAGG - Intronic
1146706287 17:35002970-35002992 GCAAGGCAACAAGAGGACATAGG - Intronic
1148229120 17:45920230-45920252 GCCAGGTGACAGGAGGACAGAGG - Intronic
1149425406 17:56550042-56550064 CCTAGCCAATATAAGGACAGAGG + Intergenic
1149982674 17:61323755-61323777 CCTAGTCCCCAGGAGGTCAGTGG + Intronic
1150320115 17:64206601-64206623 CCCAGGCAATAAGAGTACAGTGG + Intronic
1150400437 17:64851861-64851883 CCCAGGCTACAGGCGGACATGGG + Intergenic
1151097392 17:71514212-71514234 GTTAGGCAACAAGAAGACAGGGG + Intergenic
1152650702 17:81491345-81491367 CGTGGCCAACAGGAGGGCAGGGG - Intergenic
1152662242 17:81547907-81547929 CTTGGGCCACAGGAGGAAAGAGG + Intronic
1152790041 17:82273811-82273833 CCGGGGTAACAGGAGGGCAGAGG - Intergenic
1152854759 17:82658440-82658462 CCTCGGCATCTGGAGGGCAGAGG + Intronic
1153641605 18:7162537-7162559 CCTTGGCAGCAGGAGGAAGGAGG - Intergenic
1157318890 18:46619301-46619323 ACTAGGGAACAGGTGGGCAGAGG - Intronic
1157331294 18:46705625-46705647 CCTCTGCCACAGGAGGCCAGAGG - Intronic
1158036447 18:53037361-53037383 CCTACTTAACAGGAAGACAGTGG + Intronic
1158106328 18:53888778-53888800 CCCAGGCAGCAGGAGTGCAGTGG - Intergenic
1158640690 18:59201185-59201207 TCTAAGCAAAAGGAGGGCAGGGG - Intergenic
1159234396 18:65651963-65651985 CCTAAGAAACAGGAGCACTGAGG - Intergenic
1160201029 18:76795620-76795642 CCCAGGCTACAGGACAACAGTGG - Exonic
1161480476 19:4507898-4507920 CCTAGGCCAGAGGAAGAGAGCGG + Intronic
1161673476 19:5627795-5627817 ACTATGCCACGGGAGGACAGAGG - Intronic
1162015604 19:7845043-7845065 CCCAGGCAGCAGGGGGACATTGG - Intronic
1163290362 19:16375849-16375871 CCCAGGGGACAGGAGGAGAGAGG + Intronic
1163381968 19:16975130-16975152 CCAAGGCCACGGGAAGACAGAGG + Exonic
1164521079 19:28980409-28980431 ACTTGGCCACTGGAGGACAGTGG - Intergenic
1165613627 19:37179135-37179157 CCTAGGGAACAAGAGGAATGTGG - Intronic
1165749405 19:38251148-38251170 CAGAGGCCACAGGAGGAGAGAGG + Intronic
1167462858 19:49635570-49635592 CCTGGGCTACAGGAGGACGCAGG + Exonic
1168699496 19:58428251-58428273 CCTAGGCCTCAGGAGGACCCAGG + Intergenic
925863550 2:8203273-8203295 CCTAGGTGACAGGTGGGCAGTGG + Intergenic
925871735 2:8277775-8277797 CCCAGGCCACGGGAGCACAGAGG + Intergenic
927423461 2:22956237-22956259 CCTAGAAAACAGGAACACAGTGG + Intergenic
929903445 2:46025702-46025724 CCTACCCCACAGGAGCACAGTGG + Intronic
929918608 2:46156244-46156266 CCTAGGCAAAAAGGGCACAGGGG - Intronic
930016523 2:46974613-46974635 ACTAGGGAAAAGGAGGAAAGAGG + Intronic
931880102 2:66559820-66559842 CCTAGGCAACAGAATGAGACAGG - Intronic
931934247 2:67178289-67178311 CCTAGGAAACAGGAGATCAAAGG - Intergenic
933137557 2:78757318-78757340 CCTTGGCAACTGGAAGACAGAGG + Intergenic
934121420 2:88843873-88843895 GCTCAGCAACACGAGGACAGGGG + Intergenic
934656491 2:96119116-96119138 CCTGTGGAACAGGATGACAGTGG - Intergenic
937439353 2:121903335-121903357 ACTCGGCACCAGGAGCACAGGGG + Intergenic
939538485 2:143462992-143463014 CCTGGGCCACAGGAGGACTAGGG - Intronic
941531625 2:166677909-166677931 CATAGGAAATAGGAGGACATGGG + Intergenic
942932005 2:181505325-181505347 CCAAGTTAACAGGAGGACATGGG + Intronic
945557630 2:211298989-211299011 TGTAGGCAAGTGGAGGACAGTGG + Intergenic
946311387 2:218884131-218884153 TAAAGGGAACAGGAGGACAGAGG - Intronic
947903770 2:233744291-233744313 CCTCGGCCACAGGAGGGAAGAGG + Intronic
947905159 2:233755642-233755664 CCTCGGCCACAGGAGGGAAGAGG + Intronic
948309766 2:236976447-236976469 CCCAGGGAAGAGGAAGACAGTGG - Intergenic
948379102 2:237540780-237540802 CCTAGGAAAGAGAAGGACGGAGG - Exonic
1169931701 20:10839941-10839963 CATGGGCAGCAGGAGGGCAGGGG - Intergenic
1171769011 20:29307165-29307187 CCTAGGCAACGGAGGGAGAGAGG + Intergenic
1175149214 20:56919969-56919991 CCTGGGCAACAAGAGGGCGGTGG - Intergenic
1178300725 21:31450555-31450577 CAGAGGCACCAGGGGGACAGGGG + Intronic
1179033848 21:37743112-37743134 CTTAGCCCACAGGATGACAGTGG + Intronic
1179056676 21:37942518-37942540 CCTGGGCAACAGAGTGACAGAGG + Intergenic
1183254769 22:36755368-36755390 CAAAGGCAACAGGAAGCCAGAGG - Intergenic
1183355843 22:37358956-37358978 CATAGGAAGCAGGAGGACTGGGG + Intergenic
1183983510 22:41556435-41556457 CCAAGGCTCCAGGAAGACAGCGG - Intergenic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184154400 22:42657743-42657765 CCCAGGGAACAGGGGGGCAGAGG - Intergenic
1184567415 22:45300371-45300393 CCTAGGCAGCACCAGGGCAGAGG + Intergenic
1185103440 22:48853960-48853982 TCTGGGCAACAAGAAGACAGAGG + Intergenic
949269517 3:2197987-2198009 CCTGGGCAACAGAGGAACAGAGG + Intronic
950158596 3:10742455-10742477 CCTGGGCCACAGGGGGACTGGGG + Intergenic
950545486 3:13635794-13635816 CCTGGGCTCCAGGAGGGCAGGGG - Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
952516826 3:34112884-34112906 GCTAGGCATGATGAGGACAGAGG - Intergenic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
953179971 3:40585931-40585953 CCAAGGGAAGAGGAGGCCAGTGG - Intergenic
953392314 3:42540736-42540758 CCTTTGCAGCAGGAGCACAGTGG + Intergenic
953617414 3:44503525-44503547 CATAGGCAACAGGAGGCATGTGG - Intronic
953693947 3:45143300-45143322 CCTTGGCAACATGAGGATAATGG + Intronic
954553895 3:51503557-51503579 TCTAGCCAACAGGAGAGCAGGGG - Intergenic
954562059 3:51565361-51565383 CCCAGGCAGCTGGAGTACAGTGG - Intronic
954584115 3:51719328-51719350 TCTAGGCCACAGGAGGGCAGCGG - Intergenic
954977794 3:54712971-54712993 CCTAGACATCATGGGGACAGGGG + Intronic
955485152 3:59427800-59427822 TGTAGGCTCCAGGAGGACAGGGG - Intergenic
955982349 3:64539744-64539766 CCTAGGCAACAGGAGGACAGAGG - Intronic
956096854 3:65725464-65725486 ACAAGACAGCAGGAGGACAGAGG + Intronic
960705986 3:120481360-120481382 CCTAGGGAACAGGAAGAAAATGG + Intergenic
967782936 3:193459475-193459497 CCCAGGCTGGAGGAGGACAGTGG + Intronic
968395692 4:234619-234641 CCTAGGCTACTGCAGGAAAGAGG - Intergenic
968399944 4:285353-285375 CCTAGGCTACTGGAGGAAACAGG + Intronic
969150121 4:5162167-5162189 CCCAGGCTCCAGGAGGACAGAGG - Intronic
969327273 4:6451307-6451329 CCTGGGCTACAGGAGGGCAGGGG - Intronic
969558630 4:7931092-7931114 CGTGGGCAACAGGAGGAGCGGGG + Intronic
970598254 4:17619337-17619359 TCCAGGCACTAGGAGGACAGTGG + Intronic
976230843 4:82841613-82841635 CCTAGGCAACAGAATGAGACTGG + Intronic
980266315 4:130521537-130521559 CCTTGGCAAAAGGATGACAGTGG + Intergenic
982913870 4:161180477-161180499 CCTAGGGAAATGGAGGTCAGGGG - Intergenic
983839431 4:172438233-172438255 CATAGTCATCTGGAGGACAGAGG - Intronic
986700859 5:10407115-10407137 CCAAAGCATCAGGAGGACAATGG - Exonic
988891079 5:35617910-35617932 CCTTGGCTACAGGAGGACGCGGG + Exonic
989411369 5:41122968-41122990 CCTATGCCCCAGGAAGACAGTGG + Intergenic
990305863 5:54493587-54493609 CCTAGGCAACAGGTGGAACCTGG + Intergenic
992905874 5:81345141-81345163 TCTAAGCAACAGGAGGATAAGGG + Intronic
995088042 5:108138710-108138732 ACTAGGCAACAGGGAGACATTGG + Intronic
995777368 5:115738350-115738372 CCTAGGAAATAGCAGAACAGTGG + Intergenic
997031852 5:130139067-130139089 TCTAGGCAACAGTAAGACAATGG + Intronic
997733573 5:136197680-136197702 CCCAGGCAGCAGGAGGAATGTGG - Intergenic
997844648 5:137275768-137275790 CCTCAGCAGCAGGTGGACAGAGG - Intronic
998438063 5:142130777-142130799 TCTAGGTAATAGGAGTACAGGGG - Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
999276494 5:150334094-150334116 TGTAGGCAACCAGAGGACAGAGG + Intronic
999965190 5:156801725-156801747 GCAAGGCAGCAAGAGGACAGAGG - Intergenic
1000975066 5:167755695-167755717 AATAGGCAAAAGGAAGACAGGGG + Intronic
1001071224 5:168586993-168587015 CGTAGGCTCCAGGAGGGCAGGGG - Intergenic
1003359707 6:5413038-5413060 CCTAGGAATCAGGTGGAGAGAGG + Intronic
1006019524 6:31109859-31109881 CATAAGCACCACGAGGACAGGGG - Intergenic
1006819919 6:36884936-36884958 ACTAGGAAACAGTAGAACAGTGG - Intronic
1007249006 6:40482962-40482984 CCAAGGGAACAGAGGGACAGTGG - Intronic
1007476171 6:42121529-42121551 CCCAGGCATGAGGAGGCCAGTGG - Intronic
1007538243 6:42615488-42615510 CCCAGGCAACAGGAGTGCAGTGG + Intronic
1007691344 6:43703331-43703353 CCTTGGGCACTGGAGGACAGAGG + Intergenic
1011422316 6:87186140-87186162 CATAGGTAACTTGAGGACAGGGG - Intronic
1011655039 6:89544388-89544410 CCTGGGGAACAGGCGGAAAGGGG - Intronic
1013756721 6:113470684-113470706 CCTAAGCTACAAGAGGACAGGGG + Intergenic
1014022902 6:116611189-116611211 CCTACGCTACATGAGCACAGAGG + Intergenic
1015088836 6:129329785-129329807 CCTGGGCCACAGGAGGATATTGG + Intronic
1016401939 6:143690306-143690328 CCAAGACAACAGCTGGACAGTGG - Intronic
1017399407 6:154042002-154042024 CCAAGTCAACAAGAGGCCAGAGG - Intronic
1017680382 6:156857894-156857916 TCTAGGCAACTGGAACACAGTGG + Intronic
1019194314 6:170272350-170272372 CGTAGCCAGCTGGAGGACAGGGG + Intergenic
1020063561 7:5170374-5170396 CCCCGGCACCTGGAGGACAGAGG - Intergenic
1020193879 7:6022003-6022025 CCTCAGCGACATGAGGACAGTGG + Intronic
1020560954 7:9728219-9728241 CCAAGGCCACAGGAAGACGGAGG - Intergenic
1022964588 7:35460627-35460649 CCTAGGAAGGAGGAGGACTGAGG + Intergenic
1023274878 7:38507813-38507835 TCATGGCAACAGGAGGGCAGGGG + Intronic
1027893210 7:84004977-84004999 CCTACTCAACAGGAAGACAAGGG + Intronic
1029507673 7:100972098-100972120 CCTCTGCAAGAGGAGGGCAGGGG - Intronic
1030914669 7:115297584-115297606 TCTAGGCACCATGAGGATAGGGG - Intergenic
1033238860 7:139660499-139660521 CCCAGGCAGCATGGGGACAGAGG + Intronic
1034155258 7:148951044-148951066 ACTAGGCTACTTGAGGACAGAGG - Intergenic
1034533200 7:151710304-151710326 CCTCGGCAGCTGGGGGACAGGGG - Intronic
1034821367 7:154219610-154219632 CCTGGGCAACAGAACGATAGTGG - Intronic
1035877986 8:3212372-3212394 CCTGGGCAACAGATCGACAGAGG - Intronic
1037193751 8:16160829-16160851 GCTAGGCAGAAGGATGACAGAGG + Intronic
1037841833 8:22250413-22250435 CCTTGGAGACAGTAGGACAGGGG + Exonic
1040487695 8:47889429-47889451 CACAGACAACAGGTGGACAGAGG + Intronic
1045869107 8:106905077-106905099 ACTAGGCAACAGGAAGACTAAGG - Intergenic
1047179706 8:122575401-122575423 CCTAAGAAAAGGGAGGACAGAGG + Intergenic
1047391142 8:124452253-124452275 TCTAGCCAACTGAAGGACAGGGG - Exonic
1047514229 8:125539571-125539593 CCTGGCCAACAGAAGGACACGGG + Intergenic
1049694691 8:143977448-143977470 CCTGGGAAGCAGGAGGCCAGAGG + Exonic
1051388625 9:16539500-16539522 CCTGGGCAACAGAGGGAGAGAGG + Intronic
1052707296 9:32009054-32009076 CCAAGGAAAAAGGAGGACTGCGG - Intergenic
1052906072 9:33835171-33835193 CCTAGGCAACAGAAAGAGATTGG - Intronic
1056904638 9:90634643-90634665 CATTGGCAAAAGGAGGAAAGTGG + Intronic
1059505705 9:114797969-114797991 CTCAGGCATCAGGAAGACAGAGG + Intronic
1061395963 9:130343444-130343466 CCTAGGCAAGGGGAGGACCTGGG + Intronic
1061484037 9:130911435-130911457 CCCAGGCAGCAGGAGGACAGAGG - Intronic
1062460811 9:136661865-136661887 CCCAGGCATCAGGCCGACAGGGG + Intronic
1188640100 X:32490451-32490473 CCTGGGTAACAGGAGAAGAGCGG - Intronic
1192319802 X:70081285-70081307 CTAAGGCAACAGGAGGATGGGGG + Intergenic
1196102563 X:111863116-111863138 ACTAGGCAATAGCAGAACAGTGG + Intronic
1197176131 X:123487436-123487458 CATAGGCTACAGAAGGAAAGTGG - Intronic
1197765532 X:130057281-130057303 CCTAGGCAAGGGCAGGAAAGTGG + Exonic
1199267517 X:145845645-145845667 CCCTGGCAACTGGAGCACAGAGG + Intergenic
1199986427 X:152955355-152955377 ACTGGGAAACAGGAGGACAGTGG + Intronic
1200255969 X:154583383-154583405 CTTAGGAAGCAGGAAGACAGAGG - Intergenic
1200261800 X:154621020-154621042 CTTAGGAAGCAGGAAGACAGAGG + Intergenic
1202090037 Y:21179565-21179587 CCTAGACCACAAGAGGACTGAGG + Intergenic