ID: 955985411

View in Genome Browser
Species Human (GRCh38)
Location 3:64568645-64568667
Sequence AAACTGGCGCTGTAAAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955985411_955985419 7 Left 955985411 3:64568645-64568667 CCCCTCTTTTACAGCGCCAGTTT 0: 1
1: 0
2: 2
3: 5
4: 101
Right 955985419 3:64568675-64568697 ATCTCAAGGCTTAATAGGGAAGG 0: 1
1: 0
2: 1
3: 17
4: 129
955985411_955985417 2 Left 955985411 3:64568645-64568667 CCCCTCTTTTACAGCGCCAGTTT 0: 1
1: 0
2: 2
3: 5
4: 101
Right 955985417 3:64568670-64568692 ATAATATCTCAAGGCTTAATAGG 0: 1
1: 0
2: 1
3: 13
4: 182
955985411_955985420 11 Left 955985411 3:64568645-64568667 CCCCTCTTTTACAGCGCCAGTTT 0: 1
1: 0
2: 2
3: 5
4: 101
Right 955985420 3:64568679-64568701 CAAGGCTTAATAGGGAAGGAAGG 0: 1
1: 0
2: 0
3: 24
4: 226
955985411_955985421 14 Left 955985411 3:64568645-64568667 CCCCTCTTTTACAGCGCCAGTTT 0: 1
1: 0
2: 2
3: 5
4: 101
Right 955985421 3:64568682-64568704 GGCTTAATAGGGAAGGAAGGTGG 0: 1
1: 0
2: 1
3: 36
4: 323
955985411_955985416 -7 Left 955985411 3:64568645-64568667 CCCCTCTTTTACAGCGCCAGTTT 0: 1
1: 0
2: 2
3: 5
4: 101
Right 955985416 3:64568661-64568683 CCAGTTTGGATAATATCTCAAGG 0: 1
1: 0
2: 0
3: 11
4: 148
955985411_955985418 3 Left 955985411 3:64568645-64568667 CCCCTCTTTTACAGCGCCAGTTT 0: 1
1: 0
2: 2
3: 5
4: 101
Right 955985418 3:64568671-64568693 TAATATCTCAAGGCTTAATAGGG 0: 1
1: 0
2: 3
3: 68
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955985411 Original CRISPR AAACTGGCGCTGTAAAAGAG GGG (reversed) Intronic
902463999 1:16603365-16603387 GAACTGGGGCTGTGGAAGAGTGG + Intronic
903157100 1:21453310-21453332 GAACTGGGGCTGTGGAAGAGTGG - Intronic
904056427 1:27673540-27673562 CAAATGGGGCTGTAATAGAGTGG + Intergenic
913088967 1:115463339-115463361 GAATTGGGGCTGTAAAGGAGGGG - Intergenic
914684571 1:149967136-149967158 AAACTTGTGCTGTCAAAGAATGG - Intronic
919255525 1:195117284-195117306 AAACCTGCGGTGTAAAAGATTGG + Intergenic
919337756 1:196261562-196261584 AAAATGGGGATGAAAAAGAGAGG + Intronic
924504750 1:244671342-244671364 AAAGTGGTGCTGTACAAGGGAGG - Intronic
1066098417 10:32095055-32095077 ACACTGGCTCTGAAAAAGAAAGG + Intergenic
1073336235 10:102712119-102712141 AACCTGGCACTGTAAAGCAGGGG + Intronic
1078554114 11:12304711-12304733 AAACTGTCACTGTAATACAGTGG - Intronic
1079844089 11:25442409-25442431 AAACTGGCTGTTTAAATGAGGGG + Intergenic
1080287133 11:30628330-30628352 ACACTGGAGCTGTACAAGACAGG - Intergenic
1080463286 11:32474324-32474346 CTGCTGGCCCTGTAAAAGAGAGG - Intergenic
1081514716 11:43815735-43815757 AATCTGGCACTGTATAAGTGAGG - Intronic
1082720379 11:56667900-56667922 AAACTGGAGATGTAAAAGAGTGG - Intergenic
1085206771 11:74738711-74738733 AAACTGACGCAGTACAAGAAGGG - Intergenic
1090657980 11:128860349-128860371 ATACTGACAATGTAAAAGAGAGG + Intronic
1091960617 12:4691124-4691146 AAACTGAGGCTGACAAAGAGAGG - Exonic
1092102564 12:5898084-5898106 AAACAGGCACTTTAAAAAAGAGG + Intronic
1093943307 12:25079702-25079724 AAACTCGCTCTGTAAGAAAGAGG + Exonic
1094832251 12:34305728-34305750 AAAATGGCGCAGTAGAGGAGGGG + Intergenic
1095395162 12:41754675-41754697 GGACTGGAGCTGTAAAGGAGTGG - Intergenic
1096757758 12:53814388-53814410 ACACTGGCACTGAAAAAGAATGG - Intergenic
1105163147 13:17466949-17466971 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105164003 13:17480363-17480385 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105167496 13:17535452-17535474 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1105188652 13:17865178-17865200 AAACTGCTGCTTCAAAAGAGAGG - Intergenic
1106116826 13:26824871-26824893 AAGCTGGAGCTGTAGATGAGTGG + Intergenic
1110331753 13:74280861-74280883 AAACTGGCACAGAAAAAGGGAGG + Intergenic
1110528764 13:76571845-76571867 AAGCTGGGGCTTTTAAAGAGAGG - Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1119455531 14:74752185-74752207 AAACTAGCAATCTAAAAGAGAGG + Intergenic
1120631205 14:86892823-86892845 AAACTGGAGCTGTACAACAATGG + Intergenic
1122405870 14:101500723-101500745 AAACAGGCCCTGGAAGAGAGAGG - Intergenic
1129248716 15:74296315-74296337 AAACTGGGGCTCAAAAAAAGAGG + Intronic
1131723718 15:95200626-95200648 AAACTGGTGCTGGTAGAGAGAGG + Intergenic
1135871902 16:26158935-26158957 GAACTGAGACTGTAAAAGAGTGG - Intergenic
1138832215 16:60388417-60388439 AATGTAGCTCTGTAAAAGAGTGG - Intergenic
1139834906 16:69830438-69830460 AAACTGGCTTTGTAAAAATGAGG + Intronic
1141866741 16:86755545-86755567 AAACTGGCTGTGATAAAGAGCGG - Intergenic
1144676025 17:17162233-17162255 AGACTGCCGCTGTAGAGGAGGGG - Intronic
1145287046 17:21513591-21513613 AAACTGTCTCTGTCAAAGAAAGG + Intergenic
1150520138 17:65857947-65857969 AAACTGACTCTGTAAAAGACCGG - Intronic
1157371190 18:47113866-47113888 AAACTTGCCCTGTTGAAGAGTGG + Intronic
1158428910 18:57365955-57365977 CAACTGGCTCTGGAAAACAGTGG + Exonic
1160389324 18:78518305-78518327 AAACTGGAGCTGAAAACGACAGG - Intergenic
1161633213 19:5369941-5369963 GACCTGGGGATGTAAAAGAGGGG - Intergenic
1202679657 1_KI270711v1_random:40805-40827 GAACTGGGGCTGTGGAAGAGTGG + Intergenic
929778733 2:44944109-44944131 AAGCTGGCGGTGGAAAAGTGGGG - Intronic
931701773 2:64914888-64914910 AAACTCGCCCTGTTACAGAGTGG - Intergenic
933009129 2:77035425-77035447 TAACTGTGGCTGTAAAAGGGAGG - Intronic
937522086 2:122724076-122724098 AAAATTTCACTGTAAAAGAGAGG - Intergenic
938624562 2:133094190-133094212 AGACTGGCACTGTGAAAGTGAGG + Intronic
939625161 2:144467984-144468006 AAACTGGAGCAGTGAGAGAGGGG + Intronic
939929727 2:148217868-148217890 AAACTGGCCCTTGAAAAGAAGGG - Intronic
941417412 2:165238544-165238566 AAAATGGTGTTGTAAAAAAGTGG + Intergenic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1182675618 22:32036782-32036804 AAACTGGCTTTATAAAGGAGAGG + Intergenic
1184736060 22:46398370-46398392 AAACAGGAGCTGTTAAAGTGGGG + Intronic
951532575 3:23711652-23711674 AATCTGGCCTTGTAAAGGAGAGG + Intergenic
951546440 3:23830684-23830706 AAACTGTCCCTGTTTAAGAGTGG + Intronic
951892662 3:27581595-27581617 GAACTGTTGCTGTCAAAGAGAGG - Intergenic
955985411 3:64568645-64568667 AAACTGGCGCTGTAAAAGAGGGG - Intronic
956505938 3:69940170-69940192 AAACTGAGGCTTTAAAAGATTGG + Intronic
960461106 3:117937155-117937177 AGAATGACCCTGTAAAAGAGAGG - Intergenic
962461754 3:135620698-135620720 AAACTGTGGTTGTAGAAGAGAGG + Intergenic
970267557 4:14306066-14306088 AAACAGGCCATGGAAAAGAGAGG + Intergenic
971425195 4:26508924-26508946 AATCTGGTGCTGTGGAAGAGAGG - Intergenic
975691859 4:76973287-76973309 AGGCTGGGGCTGGAAAAGAGAGG - Intronic
976957446 4:90917884-90917906 AAACTGACACTGTAAAAGAGGGG - Intronic
978635434 4:110799212-110799234 AAACTGCCTATGTAAATGAGAGG + Intergenic
979970204 4:127125222-127125244 AAACTTGGGCTGAAAAAGGGTGG + Intergenic
982153150 4:152485778-152485800 AAACTGGTGCTATAAAAATGAGG + Intronic
992955706 5:81906217-81906239 GAACCGGTGCTGAAAAAGAGTGG + Intergenic
996134883 5:119829298-119829320 AAAGTGGGACTGTAAAAGAGGGG + Intergenic
999161941 5:149508723-149508745 AAACTAGTGCTGGAAAAGAAAGG - Intronic
999581781 5:153046776-153046798 ATACTGTAGCTGTAAAAGAATGG + Intergenic
1005262906 6:24080913-24080935 AAACTGGCATTGTAAATGTGCGG + Intergenic
1005677537 6:28170782-28170804 AAATTGGCACTGTAGAACAGTGG - Intergenic
1007125241 6:39420730-39420752 AAACTGGCTCTATAAAAGACGGG - Intronic
1007839703 6:44705775-44705797 AAGCTGGGCCTGCAAAAGAGGGG - Intergenic
1010059651 6:71607905-71607927 AAACTGGTGCTTTAAAAAAATGG + Intergenic
1010660381 6:78563603-78563625 AATCTAGCACTCTAAAAGAGAGG + Intergenic
1011094463 6:83644430-83644452 AAACTGGCACTTTTAAAGAGGGG + Intronic
1014208717 6:118685780-118685802 AAAATGGAGGTGGAAAAGAGAGG + Intronic
1014248744 6:119094868-119094890 AGAATGGCCCTGCAAAAGAGGGG + Intronic
1014521045 6:122442448-122442470 AAAATGCCACTGTCAAAGAGAGG - Intergenic
1015843209 6:137494395-137494417 AACCTCACGCTGAAAAAGAGGGG + Intergenic
1018969247 6:168514688-168514710 AAACAAGCGCTGTAGAAGTGGGG + Intronic
1021233301 7:18111421-18111443 AAAATGAAGCTGGAAAAGAGTGG + Intronic
1023745729 7:43320838-43320860 AAATGGGCCCTCTAAAAGAGAGG + Intronic
1029335180 7:99892808-99892830 AAACTGATGCTGGAAAAGATGGG - Intronic
1032310628 7:130782974-130782996 AAGTTGGCACTGTAAAATAGAGG - Intergenic
1036080110 8:5545910-5545932 AAACTGGCACTGAACAAGATAGG - Intergenic
1037077438 8:14738277-14738299 ATACTGAGGCTGTACAAGAGGGG - Intronic
1039341916 8:36659796-36659818 AAACTGGAGGTGTAATAGGGAGG - Intergenic
1039445175 8:37625478-37625500 AAACAAGCTCTGTAAAAGATAGG + Intergenic
1040272832 8:45975353-45975375 AAACTGGTCCTTTAAAAGAAAGG - Intergenic
1049325990 8:142021801-142021823 GAACTGGCCCTGTAGAACAGGGG + Intergenic
1051880380 9:21833901-21833923 ACACTGGCACTTTCAAAGAGAGG - Intronic
1058778862 9:108312925-108312947 TAATTGGTGCTGTAAAAAAGTGG + Intergenic
1203379054 Un_KI270435v1:12325-12347 AAACTGGTCCATTAAAAGAGAGG - Intergenic
1187588606 X:20691101-20691123 ACAATGGCGAGGTAAAAGAGAGG + Intergenic
1188598043 X:31925538-31925560 CAACTGGGGCAGAAAAAGAGTGG + Intronic
1188673604 X:32911268-32911290 AAACTGGCGGTGGGAAAGAGAGG + Intronic
1193120705 X:77820144-77820166 TAACTGTCGCTGTGAAAGATGGG + Intergenic
1198177106 X:134167396-134167418 AAAGTAGCTCAGTAAAAGAGGGG - Intergenic
1199297276 X:146173518-146173540 ATCCTGGCTCTGTAAAAAAGTGG + Intergenic