ID: 955988043

View in Genome Browser
Species Human (GRCh38)
Location 3:64595552-64595574
Sequence CAGGACAGAACTTTGCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955988036_955988043 7 Left 955988036 3:64595522-64595544 CCAATTACAGAAGCTTAATCACA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 955988043 3:64595552-64595574 CAGGACAGAACTTTGCGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 118
955988035_955988043 19 Left 955988035 3:64595510-64595532 CCTGGCTTGAATCCAATTACAGA 0: 1
1: 0
2: 0
3: 11
4: 203
Right 955988043 3:64595552-64595574 CAGGACAGAACTTTGCGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955988043 Original CRISPR CAGGACAGAACTTTGCGAGG AGG Intronic
902862539 1:19256710-19256732 CAGGACAGAAACTTGCCATGTGG - Intronic
906235381 1:44204500-44204522 AAGGCCAGCACTTTGGGAGGAGG - Intergenic
906748567 1:48238898-48238920 CATGACAGAAGTTTGGGAAGGGG + Intronic
909251239 1:73359310-73359332 CAGGATATAACCTTGTGAGGGGG + Intergenic
909898813 1:81108479-81108501 CAGGAATGAACTTGGTGAGGTGG - Intergenic
910250943 1:85199010-85199032 CAGGAAAAAACTTTGCAAGTTGG + Intronic
912501923 1:110128481-110128503 CAGGACAAAACTTTGAGCTGAGG + Intergenic
916254396 1:162771945-162771967 CAGGAAGGAACTCTGAGAGGAGG - Intronic
920200463 1:204257020-204257042 CTGGACAGATCATTGCAAGGGGG - Intronic
922096367 1:222446290-222446312 CAGGTCAGAACTTGGGGATGGGG - Intergenic
922874439 1:228928853-228928875 CAGGACAGAAGTAAGCTAGGGGG + Intergenic
1063549075 10:7011901-7011923 AAGGAGAGAAGTTTGCAAGGTGG - Intergenic
1063561609 10:7133540-7133562 CAGGACGGAACTGTGCTACGCGG - Intergenic
1066171944 10:32858152-32858174 AAGGTCAGAACATTTCGAGGTGG + Intronic
1067350083 10:45467660-45467682 CAGGACAGAACCTTACTAGATGG + Intronic
1067474332 10:46556302-46556324 CAGGACAGGACAATGAGAGGCGG + Intergenic
1068116034 10:52739012-52739034 CAGGAAAGAGTTGTGCGAGGGGG + Intergenic
1069729410 10:70601198-70601220 CAGGACACAACTGTGGGTGGTGG + Intronic
1070550345 10:77486167-77486189 CAGGACAGACCTTCAGGAGGAGG + Intronic
1075446836 10:122519117-122519139 CATGACAGAACATTGAGAGCAGG - Intergenic
1075691814 10:124401303-124401325 GAGGACAGATCTTTGTGAGGGGG - Intronic
1075760052 10:124848806-124848828 AATGCCAGAACTTTGAGAGGTGG - Intergenic
1077188483 11:1245938-1245960 CTGGTCAGCACTTTGGGAGGGGG - Exonic
1077189442 11:1249709-1249731 CTGGTCAGCACTTTGGGAGGGGG - Exonic
1081720369 11:45284721-45284743 CAGGAAAGAAGGTTGAGAGGCGG + Intronic
1091207663 11:133832767-133832789 CAGGGCAGGACTTCGCGGGGCGG - Intergenic
1093084179 12:14848269-14848291 CAGGACTGAGCTTTTAGAGGTGG + Intronic
1095785533 12:46105230-46105252 CAGGGGAGAATTTGGCGAGGGGG - Intergenic
1096459741 12:51815450-51815472 CATCACAGCACTTTGGGAGGTGG - Intergenic
1096499253 12:52055295-52055317 CAGGACAGGACTTAGCTAGGAGG - Intronic
1101519142 12:105465591-105465613 AACGACAGAGCTTTGTGAGGTGG + Intergenic
1102666022 12:114573615-114573637 CATGTCAGCACTTTGGGAGGTGG + Intergenic
1102752152 12:115304548-115304570 CAGGGGAGAAGTTTGGGAGGGGG - Intergenic
1104930342 12:132336163-132336185 CAGAGCAGCCCTTTGCGAGGGGG + Intergenic
1105216397 13:18289118-18289140 CAGAACAGAACTCTGCTATGGGG + Intergenic
1109839555 13:67904362-67904384 CACGCCAGAACGTTGGGAGGCGG - Intergenic
1111098087 13:83540495-83540517 CAGGGAAGAATTTTGAGAGGAGG + Intergenic
1112692481 13:101913345-101913367 AAGGACAGAAATTTGCAAGATGG - Intronic
1114137914 14:19873956-19873978 CATCCCAGCACTTTGCGAGGTGG + Intergenic
1114982409 14:28181385-28181407 CAGGAAAGAACTCCTCGAGGGGG + Intergenic
1117315936 14:54570189-54570211 CAGGACAGAAATTTCTTAGGAGG + Intronic
1118107541 14:62677009-62677031 AAGGACAGAACAAAGCGAGGGGG + Intergenic
1118239608 14:64043761-64043783 CAAGACAGAAGTTTGCTACGGGG + Intronic
1120324402 14:83006992-83007014 CAGGACATCACATGGCGAGGAGG + Intergenic
1128107507 15:65055541-65055563 CAGGCCAGAATTTTGGGATGAGG + Intronic
1129121514 15:73399851-73399873 GAAGACAGAACTCTGGGAGGAGG + Intergenic
1131873197 15:96780914-96780936 CAGCACAGGACTTGGGGAGGGGG - Intergenic
1132271295 15:100528361-100528383 CAGCACAGATCTTTGCCAGGTGG - Intronic
1134441296 16:14301289-14301311 GAGGCCAGATCTTTGCCAGGTGG + Intergenic
1137756980 16:50910200-50910222 CAGGGCAGACCTCTGTGAGGAGG - Intergenic
1139167870 16:64591334-64591356 CAGGACAGGAATATGAGAGGGGG - Intergenic
1139757145 16:69153171-69153193 CAGGGCAGAACATTCTGAGGAGG - Intronic
1141691396 16:85598767-85598789 CTGGACAGAACTTTTGGAAGAGG - Intergenic
1142124436 16:88403114-88403136 CAGGAGAGAACCTTGGGTGGAGG + Intergenic
1146581737 17:34044577-34044599 GAGGACAGAACTTTTCAATGAGG + Intronic
1148437857 17:47696335-47696357 AAGGTCAGAACTTGGAGAGGAGG + Exonic
1149293807 17:55242425-55242447 CAGGACAGATATTTGAGAGTGGG - Intergenic
1150704732 17:67476736-67476758 AATGCCAGAACTTTGGGAGGTGG - Intronic
1151262033 17:72923662-72923684 CAAAACAGAACATTGCTAGGGGG + Intronic
1153489062 18:5629736-5629758 CTGGCCAGTTCTTTGCGAGGAGG - Intronic
1157175330 18:45446707-45446729 CTGCACAGACCTGTGCGAGGTGG - Intronic
1160695959 19:484683-484705 CAGGACCGCACCTGGCGAGGCGG + Intergenic
1161136027 19:2620361-2620383 CAGGACAGAGGTTTGTGAGGGGG - Intronic
1161636193 19:5390800-5390822 GAGGGCAGAACTTGGCGATGAGG - Intergenic
1163205571 19:15800084-15800106 CAGGAAAGAGCTTTCTGAGGAGG - Intergenic
932112853 2:69017255-69017277 CTGGACAGCACTGTGTGAGGAGG - Intronic
932823457 2:74920580-74920602 CTGGACAGCACTTTAGGAGGCGG - Intergenic
935634655 2:105241018-105241040 CAGGAGAGAGCTTTGGCAGGGGG + Intergenic
938842415 2:135175714-135175736 CAGGACAGAACTTGGCAAAGTGG + Intronic
946106634 2:217376050-217376072 CAGGGCAGACCTTTGGGAAGGGG + Intronic
946539047 2:220663620-220663642 CAGGAAAGAACTTGGTGAGCTGG - Intergenic
1172117609 20:32582059-32582081 CAGGAAAGAACTTGGAGATGGGG + Intronic
1173292352 20:41726030-41726052 CTGGTCAGAACATGGCGAGGGGG + Intergenic
1174118684 20:48245985-48246007 CTAGGCAGAACTTTGCAAGGTGG - Intergenic
1175521078 20:59603460-59603482 AAGGACAGAACTGAGCGGGGTGG - Intronic
1178891848 21:36526508-36526530 CAGGACCCCACTTTGCCAGGAGG - Intronic
1181018798 22:20087447-20087469 CAGGACAGAAATATCTGAGGAGG + Intronic
1181539899 22:23567443-23567465 CAGTTCAGAGCTTTGCAAGGAGG - Intergenic
1184717743 22:46291445-46291467 CAGGACAGGACTTGGAGAGAAGG - Intronic
1184792430 22:46708297-46708319 CAGGACTCAAGTTTGCGGGGCGG + Intronic
950053338 3:10008168-10008190 CAGGACAGCACTTCCAGAGGGGG - Intronic
950304977 3:11910453-11910475 CAGGACAGCACTTCCAGAGGGGG - Intergenic
955011362 3:55018361-55018383 CAGCACAGAACTTTCCCAGATGG + Intronic
955988043 3:64595552-64595574 CAGGACAGAACTTTGCGAGGAGG + Intronic
956224446 3:66940518-66940540 CAGAGGAGAACTTTGGGAGGAGG - Intergenic
963327716 3:143880615-143880637 CAGGACAGAAAGTGGAGAGGTGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
969921520 4:10544844-10544866 CAGGACAGCACATGGCGAGGAGG + Intronic
971707228 4:30060936-30060958 CAGCATAGAACTATGGGAGGAGG - Intergenic
972362115 4:38336329-38336351 CAGGACAGCACATGGGGAGGGGG - Intergenic
975464858 4:74697781-74697803 CAGGACAGAAATTACCGGGGAGG + Intergenic
978486480 4:109260432-109260454 CAAGACAAGACTTTGGGAGGGGG - Intronic
980773549 4:137409772-137409794 CATGCCAGCACTTTGGGAGGTGG - Intergenic
982085282 4:151829461-151829483 CGGGACAGATATTTGCGAGAGGG + Intergenic
982557517 4:156886762-156886784 CTGGACACAACTATGTGAGGAGG + Intronic
983380326 4:166982934-166982956 CAGGAAAGAACTTAGGGAAGAGG - Intronic
984972367 4:185203038-185203060 CAAGACAGAGTTTTGCCAGGAGG + Intronic
985076215 4:186217722-186217744 AAGGATAGAAGTTTGCAAGGAGG + Intronic
989176570 5:38533420-38533442 CAGGACTGAACTTTGCCATGTGG - Intronic
990699744 5:58461365-58461387 CAGGCCAAAACTTTGAAAGGTGG - Intergenic
991389760 5:66129885-66129907 CATCCCAGAACTTTGGGAGGCGG + Intergenic
996095717 5:119396737-119396759 AAGCCCAGAACTTTGGGAGGCGG + Intronic
999537673 5:152535358-152535380 CAGGACATTACATGGCGAGGGGG - Intergenic
999663561 5:153890366-153890388 CAGGAAAGACCTTTCTGAGGAGG + Intergenic
1001547187 5:172577783-172577805 CAAGAAAGAACTTGGCAAGGGGG + Intergenic
1003514065 6:6803929-6803951 CAGGACACCACTAGGCGAGGAGG + Intergenic
1015736141 6:136402089-136402111 AAAGACAGAAGTTTGCCAGGGGG - Intronic
1022263755 7:28733092-28733114 CAGGACAGAAGTGTTCAAGGAGG + Intronic
1022469524 7:30673781-30673803 CAAGACAGAAATATGCCAGGTGG - Intronic
1025641076 7:63370115-63370137 AATGACAGAAGTTTGAGAGGAGG + Intergenic
1026109738 7:67449537-67449559 CAGGGCATCACTTGGCGAGGGGG + Intergenic
1029708004 7:102285761-102285783 CAGGACAGAACTGCCAGAGGTGG + Intronic
1031550782 7:123109629-123109651 CAGGAATGAACTTGGAGAGGGGG - Intergenic
1033008407 7:137592342-137592364 AAGGAAAGAACTTTGCAAGCTGG - Intronic
1034934844 7:155192311-155192333 CAGGAGAGAAATTTGAGATGAGG + Intergenic
1037582822 8:20255701-20255723 CAGAACAGAATTCTGGGAGGTGG + Intronic
1040671122 8:49691691-49691713 CAGGACAGAACCCAGCGAGGGGG - Intergenic
1047603055 8:126446469-126446491 CAGGAGAGATCTTTGTGGGGTGG + Intergenic
1056019213 9:82423975-82423997 CAAGGCAGAACTTTGCAGGGAGG + Intergenic
1056308223 9:85312596-85312618 CAGGACAGAATCTTGCTAGAGGG + Intergenic
1058913323 9:109541248-109541270 CAAGACAGAACTTTCCTTGGTGG + Intergenic
1059754361 9:117278544-117278566 CAGGAGAGAAATTTTAGAGGCGG + Intronic
1060520819 9:124292946-124292968 CAGGAGAGAAGTTTGCTGGGAGG + Exonic
1187859639 X:23668451-23668473 CAGGACACAAATTTGCCACGAGG - Intronic
1192189521 X:68982375-68982397 GAGGACAGAACTTAGCTATGAGG - Intergenic
1195940766 X:110166092-110166114 AAGGAGAGAACTTTGTGAGAAGG - Intronic
1199269302 X:145864305-145864327 CAGGCCTGAACTTGGAGAGGGGG - Intergenic