ID: 955996552

View in Genome Browser
Species Human (GRCh38)
Location 3:64685726-64685748
Sequence CCTGCGGCGCACGTTTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955996552_955996555 -2 Left 955996552 3:64685726-64685748 CCTAGGGAAACGTGCGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 955996555 3:64685747-64685769 GGCTCCCTCTCTCCACTCCCTGG 0: 1
1: 0
2: 4
3: 72
4: 537
955996552_955996563 26 Left 955996552 3:64685726-64685748 CCTAGGGAAACGTGCGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 955996563 3:64685775-64685797 GTGAGTAGTAGAAACCCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955996552 Original CRISPR CCTGCGGCGCACGTTTCCCT AGG (reversed) Intronic
907464863 1:54628218-54628240 CCTGAGGCACACACTTCCCTGGG - Intronic
919066016 1:192693553-192693575 CCTGCGGCAAACTTTTGCCTGGG + Intergenic
922944879 1:229504949-229504971 CCTGGGCCACACGTGTCCCTGGG - Intronic
1075467033 10:122659273-122659295 CATGCAGCGCACGGTCCCCTGGG + Intergenic
1075969488 10:126640361-126640383 CCTGCTCCGCAGGTTTGCCTGGG + Intronic
1085410605 11:76288278-76288300 CCTCCGGGGCCTGTTTCCCTTGG + Intergenic
1122809491 14:104281022-104281044 CCTGCGGGGCAGGTTGGCCTAGG - Intergenic
1133236103 16:4388130-4388152 CCTCAGGCGCTGGTTTCCCTGGG - Intronic
1140234412 16:73145431-73145453 CCTGCGGAGGACCTTACCCTGGG + Intergenic
1142849624 17:2698026-2698048 CCTGCTGCGCACCTTCCCCCCGG - Exonic
1147754816 17:42761287-42761309 CCGGCGGCCCGCGTCTCCCTAGG + Exonic
1148618192 17:49015380-49015402 CCTGCCCCCCACCTTTCCCTCGG + Intronic
1149934630 17:60792497-60792519 ACTGCTGCCCAAGTTTCCCTCGG - Intronic
1152595111 17:81234103-81234125 CCTGTGGAGCACGGTGCCCTGGG + Intronic
1152801767 17:82334015-82334037 CGTGCGGCGCGCGTTCCCCGCGG + Intronic
1152835086 17:82524718-82524740 CCTGAGGCGCAGGTGTTCCTGGG + Intronic
930006779 2:46904186-46904208 CCTGCAGCAAACGTTTGCCTGGG - Exonic
934015895 2:87881402-87881424 CCTGCAGCGCACTTTTTCCTGGG + Intergenic
948014609 2:234677827-234677849 CCTGCAGTGCACGTATCCATGGG + Intergenic
948189548 2:236047170-236047192 CCTGTGGCCAACGTTTCACTCGG - Intronic
948787856 2:240362437-240362459 CCTGCCGCTCACGTTCCCCAGGG + Intergenic
1174077902 20:47951210-47951232 CCTGCAGAGCACGGTTCCCCAGG - Intergenic
1174077913 20:47951246-47951268 CCTGCAGAGCACGGTTCCCCGGG - Intergenic
1174077925 20:47951282-47951304 CCTGCAGAGCACGGTTCCCCGGG - Intergenic
1174277518 20:49414618-49414640 CCTCTGGCGCCTGTTTCCCTTGG + Intronic
1175228617 20:57459859-57459881 CCTGGGGAGACCGTTTCCCTAGG + Intergenic
1176217630 20:63955836-63955858 GCTGCGGCGCACGGTGCCTTCGG - Intronic
1177740292 21:25146159-25146181 CCTGCAGCACACTTTTGCCTGGG + Intergenic
1179316411 21:40247869-40247891 CCTGCAGCGAACTTTTGCCTGGG + Intronic
1180987414 22:19913017-19913039 CAGGCGGCACACGGTTCCCTGGG + Intronic
1184652026 22:45923853-45923875 CCCTCGGCGCACGTTGCCCAAGG + Intronic
949474130 3:4426379-4426401 CATCCTGCGCAAGTTTCCCTTGG + Intronic
955996552 3:64685726-64685748 CCTGCGGCGCACGTTTCCCTAGG - Intronic
959049703 3:101513026-101513048 CCTGCGCCTCCCGTTTCCCCCGG + Intronic
961645963 3:128392929-128392951 CCTGTGGCCCTGGTTTCCCTTGG + Intronic
985110450 4:186542171-186542193 CCAGCGGAGCACCATTCCCTGGG + Intronic
994637680 5:102363343-102363365 CCTGCAGCACACTTTTGCCTGGG + Intergenic
1000947204 5:167436924-167436946 CCTGCAGCAAACTTTTCCCTAGG - Intronic
1004830839 6:19475265-19475287 CCTGCAGCACACTTTTGCCTGGG + Intergenic
1010682122 6:78809303-78809325 CCAGGGGCGCCCATTTCCCTAGG - Intergenic
1013086657 6:106863293-106863315 CCTGCAGCGAACTTTTGCCTGGG - Intergenic
1014208757 6:118686090-118686112 CCTCCAACCCACGTTTCCCTTGG - Intronic
1014730955 6:125030929-125030951 CCTGCAGCACACTTTTGCCTGGG + Intronic
1016220826 6:141668307-141668329 CTTGGGGCACATGTTTCCCTGGG + Intergenic
1019345168 7:526238-526260 CCTCCGGGGCCTGTTTCCCTGGG + Intergenic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1035404234 7:158587740-158587762 CCGGCGGCGCGCGCCTCCCTGGG - Intronic
1038139036 8:24822633-24822655 CCTGCAGCAGACGTTTGCCTGGG - Intergenic
1049650843 8:143768489-143768511 CCGCCGGCGCACGTTTCAGTGGG - Intergenic
1049905794 9:215155-215177 CCTGGGGCGCCCGGTTCCCGAGG + Exonic
1051024528 9:12591341-12591363 CCTCCTGCCCACCTTTCCCTGGG - Intergenic
1051394879 9:16609121-16609143 CCTGGGGTGCACTTTTCTCTAGG - Intronic
1062201063 9:135302931-135302953 CGTTCGGGGCACCTTTCCCTGGG - Intergenic
1186433398 X:9523370-9523392 CCTGGGGTGCCCCTTTCCCTGGG + Intronic
1194874898 X:99174881-99174903 CCTGCAGCGAACTTTTACCTGGG - Intergenic
1199128597 X:144157144-144157166 CCTGCAGCGCACTTTTTCCTGGG - Intergenic
1199420356 X:147637246-147637268 CCTGCAGCGCACCTCTGCCTTGG - Intergenic