ID: 956000727

View in Genome Browser
Species Human (GRCh38)
Location 3:64727429-64727451
Sequence CAGCTGATTGGGAGCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956000723_956000727 21 Left 956000723 3:64727385-64727407 CCGTAAGTAAAATTTGTAATGCA No data
Right 956000727 3:64727429-64727451 CAGCTGATTGGGAGCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956000727 Original CRISPR CAGCTGATTGGGAGCCACCA GGG Intergenic
No off target data available for this crispr