ID: 956002416

View in Genome Browser
Species Human (GRCh38)
Location 3:64743306-64743328
Sequence TATCCTATTCCAAGTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956002416_956002420 0 Left 956002416 3:64743306-64743328 CCTCACCCACTTGGAATAGGATA No data
Right 956002420 3:64743329-64743351 AAAGAAAATCCCCTGGATAGAGG No data
956002416_956002419 -7 Left 956002416 3:64743306-64743328 CCTCACCCACTTGGAATAGGATA No data
Right 956002419 3:64743322-64743344 TAGGATAAAAGAAAATCCCCTGG No data
956002416_956002421 1 Left 956002416 3:64743306-64743328 CCTCACCCACTTGGAATAGGATA No data
Right 956002421 3:64743330-64743352 AAGAAAATCCCCTGGATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956002416 Original CRISPR TATCCTATTCCAAGTGGGTG AGG (reversed) Intergenic
No off target data available for this crispr