ID: 956008589

View in Genome Browser
Species Human (GRCh38)
Location 3:64806439-64806461
Sequence ATGATGATGATGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956008589_956008591 24 Left 956008589 3:64806439-64806461 CCATGTTTCATCATCATCATCAT No data
Right 956008591 3:64806486-64806508 TGTGCCTGATACAGAGAACATGG No data
956008589_956008592 25 Left 956008589 3:64806439-64806461 CCATGTTTCATCATCATCATCAT No data
Right 956008592 3:64806487-64806509 GTGCCTGATACAGAGAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956008589 Original CRISPR ATGATGATGATGATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr