ID: 956010493

View in Genome Browser
Species Human (GRCh38)
Location 3:64826093-64826115
Sequence TTAACAGCAAAACACCGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956010493_956010499 8 Left 956010493 3:64826093-64826115 CCACTTCGGTGTTTTGCTGTTAA No data
Right 956010499 3:64826124-64826146 AGGCTCTAGAAGGGGTGTACAGG No data
956010493_956010497 0 Left 956010493 3:64826093-64826115 CCACTTCGGTGTTTTGCTGTTAA No data
Right 956010497 3:64826116-64826138 GCTGCCTCAGGCTCTAGAAGGGG No data
956010493_956010495 -2 Left 956010493 3:64826093-64826115 CCACTTCGGTGTTTTGCTGTTAA No data
Right 956010495 3:64826114-64826136 AAGCTGCCTCAGGCTCTAGAAGG No data
956010493_956010496 -1 Left 956010493 3:64826093-64826115 CCACTTCGGTGTTTTGCTGTTAA No data
Right 956010496 3:64826115-64826137 AGCTGCCTCAGGCTCTAGAAGGG No data
956010493_956010500 12 Left 956010493 3:64826093-64826115 CCACTTCGGTGTTTTGCTGTTAA No data
Right 956010500 3:64826128-64826150 TCTAGAAGGGGTGTACAGGAAGG No data
956010493_956010501 27 Left 956010493 3:64826093-64826115 CCACTTCGGTGTTTTGCTGTTAA No data
Right 956010501 3:64826143-64826165 CAGGAAGGAGATTCTTACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956010493 Original CRISPR TTAACAGCAAAACACCGAAG TGG (reversed) Intergenic
No off target data available for this crispr