ID: 956013753

View in Genome Browser
Species Human (GRCh38)
Location 3:64859207-64859229
Sequence ACAGCCTCTTGGATCTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956013753_956013758 18 Left 956013753 3:64859207-64859229 CCAAGATAGATCCAAGAGGCTGT No data
Right 956013758 3:64859248-64859270 CTGTATGTGGCTATGTGTTATGG No data
956013753_956013761 29 Left 956013753 3:64859207-64859229 CCAAGATAGATCCAAGAGGCTGT No data
Right 956013761 3:64859259-64859281 TATGTGTTATGGGAAAGGCAAGG No data
956013753_956013756 -9 Left 956013753 3:64859207-64859229 CCAAGATAGATCCAAGAGGCTGT No data
Right 956013756 3:64859221-64859243 AGAGGCTGTGATGCTTTGAAGGG No data
956013753_956013760 24 Left 956013753 3:64859207-64859229 CCAAGATAGATCCAAGAGGCTGT No data
Right 956013760 3:64859254-64859276 GTGGCTATGTGTTATGGGAAAGG No data
956013753_956013755 -10 Left 956013753 3:64859207-64859229 CCAAGATAGATCCAAGAGGCTGT No data
Right 956013755 3:64859220-64859242 AAGAGGCTGTGATGCTTTGAAGG No data
956013753_956013762 30 Left 956013753 3:64859207-64859229 CCAAGATAGATCCAAGAGGCTGT No data
Right 956013762 3:64859260-64859282 ATGTGTTATGGGAAAGGCAAGGG No data
956013753_956013757 5 Left 956013753 3:64859207-64859229 CCAAGATAGATCCAAGAGGCTGT No data
Right 956013757 3:64859235-64859257 TTTGAAGGGAACTCTGTATGTGG No data
956013753_956013759 19 Left 956013753 3:64859207-64859229 CCAAGATAGATCCAAGAGGCTGT No data
Right 956013759 3:64859249-64859271 TGTATGTGGCTATGTGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956013753 Original CRISPR ACAGCCTCTTGGATCTATCT TGG (reversed) Intergenic
No off target data available for this crispr