ID: 956016071

View in Genome Browser
Species Human (GRCh38)
Location 3:64884386-64884408
Sequence TCCTTATTTACATATCACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956016070_956016071 3 Left 956016070 3:64884360-64884382 CCTTACATATCACTTTTCAAGTC No data
Right 956016071 3:64884386-64884408 TCCTTATTTACATATCACCGTGG No data
956016068_956016071 29 Left 956016068 3:64884334-64884356 CCATCACTTCTCATATGTATCAG No data
Right 956016071 3:64884386-64884408 TCCTTATTTACATATCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956016071 Original CRISPR TCCTTATTTACATATCACCG TGG Intergenic
No off target data available for this crispr