ID: 956017726

View in Genome Browser
Species Human (GRCh38)
Location 3:64901706-64901728
Sequence CTGAATCAGCAGGAGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956017726_956017732 11 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017732 3:64901740-64901762 CTCCTCCAGAGAATTCATGGTGG No data
956017726_956017731 8 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017731 3:64901737-64901759 GGACTCCTCCAGAGAATTCATGG No data
956017726_956017735 16 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017735 3:64901745-64901767 CCAGAGAATTCATGGTGGTTTGG No data
956017726_956017737 25 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017737 3:64901754-64901776 TCATGGTGGTTTGGCAGCCTGGG No data
956017726_956017736 24 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017736 3:64901753-64901775 TTCATGGTGGTTTGGCAGCCTGG No data
956017726_956017738 26 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017738 3:64901755-64901777 CATGGTGGTTTGGCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956017726 Original CRISPR CTGAATCAGCAGGAGCAACC AGG (reversed) Intergenic
No off target data available for this crispr