ID: 956017729

View in Genome Browser
Species Human (GRCh38)
Location 3:64901716-64901738
Sequence CCCCTGCTTGCTGAATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956017729_956017735 6 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017735 3:64901745-64901767 CCAGAGAATTCATGGTGGTTTGG No data
956017729_956017731 -2 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017731 3:64901737-64901759 GGACTCCTCCAGAGAATTCATGG No data
956017729_956017738 16 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017738 3:64901755-64901777 CATGGTGGTTTGGCAGCCTGGGG No data
956017729_956017737 15 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017737 3:64901754-64901776 TCATGGTGGTTTGGCAGCCTGGG No data
956017729_956017732 1 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017732 3:64901740-64901762 CTCCTCCAGAGAATTCATGGTGG No data
956017729_956017739 22 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017739 3:64901761-64901783 GGTTTGGCAGCCTGGGGTTCAGG No data
956017729_956017736 14 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017736 3:64901753-64901775 TTCATGGTGGTTTGGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956017729 Original CRISPR CCCCTGCTTGCTGAATCAGC AGG (reversed) Intergenic
No off target data available for this crispr