ID: 956017732

View in Genome Browser
Species Human (GRCh38)
Location 3:64901740-64901762
Sequence CTCCTCCAGAGAATTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956017726_956017732 11 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017732 3:64901740-64901762 CTCCTCCAGAGAATTCATGGTGG No data
956017729_956017732 1 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017732 3:64901740-64901762 CTCCTCCAGAGAATTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956017732 Original CRISPR CTCCTCCAGAGAATTCATGG TGG Intergenic
No off target data available for this crispr