ID: 956017733

View in Genome Browser
Species Human (GRCh38)
Location 3:64901742-64901764
Sequence AACCACCATGAATTCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956017733_956017742 21 Left 956017733 3:64901742-64901764 CCTCCAGAGAATTCATGGTGGTT No data
Right 956017742 3:64901786-64901808 CTGCTGAGGTTCCAGCCTCCTGG No data
956017733_956017741 7 Left 956017733 3:64901742-64901764 CCTCCAGAGAATTCATGGTGGTT No data
Right 956017741 3:64901772-64901794 CTGGGGTTCAGGCTCTGCTGAGG No data
956017733_956017745 24 Left 956017733 3:64901742-64901764 CCTCCAGAGAATTCATGGTGGTT No data
Right 956017745 3:64901789-64901811 CTGAGGTTCCAGCCTCCTGGGGG No data
956017733_956017739 -4 Left 956017733 3:64901742-64901764 CCTCCAGAGAATTCATGGTGGTT No data
Right 956017739 3:64901761-64901783 GGTTTGGCAGCCTGGGGTTCAGG No data
956017733_956017738 -10 Left 956017733 3:64901742-64901764 CCTCCAGAGAATTCATGGTGGTT No data
Right 956017738 3:64901755-64901777 CATGGTGGTTTGGCAGCCTGGGG No data
956017733_956017744 23 Left 956017733 3:64901742-64901764 CCTCCAGAGAATTCATGGTGGTT No data
Right 956017744 3:64901788-64901810 GCTGAGGTTCCAGCCTCCTGGGG No data
956017733_956017743 22 Left 956017733 3:64901742-64901764 CCTCCAGAGAATTCATGGTGGTT No data
Right 956017743 3:64901787-64901809 TGCTGAGGTTCCAGCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956017733 Original CRISPR AACCACCATGAATTCTCTGG AGG (reversed) Intergenic
No off target data available for this crispr