ID: 956017735

View in Genome Browser
Species Human (GRCh38)
Location 3:64901745-64901767
Sequence CCAGAGAATTCATGGTGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956017729_956017735 6 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017735 3:64901745-64901767 CCAGAGAATTCATGGTGGTTTGG No data
956017726_956017735 16 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017735 3:64901745-64901767 CCAGAGAATTCATGGTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956017735 Original CRISPR CCAGAGAATTCATGGTGGTT TGG Intergenic
No off target data available for this crispr