ID: 956017736

View in Genome Browser
Species Human (GRCh38)
Location 3:64901753-64901775
Sequence TTCATGGTGGTTTGGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956017726_956017736 24 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017736 3:64901753-64901775 TTCATGGTGGTTTGGCAGCCTGG No data
956017729_956017736 14 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017736 3:64901753-64901775 TTCATGGTGGTTTGGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956017736 Original CRISPR TTCATGGTGGTTTGGCAGCC TGG Intergenic
No off target data available for this crispr