ID: 956017737 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:64901754-64901776 |
Sequence | TCATGGTGGTTTGGCAGCCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
956017726_956017737 | 25 | Left | 956017726 | 3:64901706-64901728 | CCTGGTTGCTCCTGCTGATTCAG | No data | ||
Right | 956017737 | 3:64901754-64901776 | TCATGGTGGTTTGGCAGCCTGGG | No data | ||||
956017729_956017737 | 15 | Left | 956017729 | 3:64901716-64901738 | CCTGCTGATTCAGCAAGCAGGGG | No data | ||
Right | 956017737 | 3:64901754-64901776 | TCATGGTGGTTTGGCAGCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
956017737 | Original CRISPR | TCATGGTGGTTTGGCAGCCT GGG | Intergenic | ||
No off target data available for this crispr |