ID: 956017738

View in Genome Browser
Species Human (GRCh38)
Location 3:64901755-64901777
Sequence CATGGTGGTTTGGCAGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956017726_956017738 26 Left 956017726 3:64901706-64901728 CCTGGTTGCTCCTGCTGATTCAG No data
Right 956017738 3:64901755-64901777 CATGGTGGTTTGGCAGCCTGGGG No data
956017733_956017738 -10 Left 956017733 3:64901742-64901764 CCTCCAGAGAATTCATGGTGGTT No data
Right 956017738 3:64901755-64901777 CATGGTGGTTTGGCAGCCTGGGG No data
956017729_956017738 16 Left 956017729 3:64901716-64901738 CCTGCTGATTCAGCAAGCAGGGG No data
Right 956017738 3:64901755-64901777 CATGGTGGTTTGGCAGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956017738 Original CRISPR CATGGTGGTTTGGCAGCCTG GGG Intergenic
No off target data available for this crispr