ID: 956020196

View in Genome Browser
Species Human (GRCh38)
Location 3:64925811-64925833
Sequence CAGGCCCAGGTGAAGCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956020196_956020205 11 Left 956020196 3:64925811-64925833 CCACAAAGCTTCACCTGGGCCTG No data
Right 956020205 3:64925845-64925867 CAATATTAAAGGATCTGTGTTGG No data
956020196_956020206 12 Left 956020196 3:64925811-64925833 CCACAAAGCTTCACCTGGGCCTG No data
Right 956020206 3:64925846-64925868 AATATTAAAGGATCTGTGTTGGG No data
956020196_956020201 0 Left 956020196 3:64925811-64925833 CCACAAAGCTTCACCTGGGCCTG No data
Right 956020201 3:64925834-64925856 GCCCCTGAGGACAATATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956020196 Original CRISPR CAGGCCCAGGTGAAGCTTTG TGG (reversed) Intergenic
No off target data available for this crispr