ID: 956021022

View in Genome Browser
Species Human (GRCh38)
Location 3:64933426-64933448
Sequence GGGTCTCTAGGAGGACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956021015_956021022 0 Left 956021015 3:64933403-64933425 CCTGAAGCATGGGGCATAATGTG No data
Right 956021022 3:64933426-64933448 GGGTCTCTAGGAGGACAGGCTGG No data
956021014_956021022 1 Left 956021014 3:64933402-64933424 CCCTGAAGCATGGGGCATAATGT No data
Right 956021022 3:64933426-64933448 GGGTCTCTAGGAGGACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956021022 Original CRISPR GGGTCTCTAGGAGGACAGGC TGG Intergenic
No off target data available for this crispr