ID: 956021199

View in Genome Browser
Species Human (GRCh38)
Location 3:64934952-64934974
Sequence CCTTGTCTGGAGGCAAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956021193_956021199 25 Left 956021193 3:64934904-64934926 CCTGGATTGTGGGCTGGAAGTTT No data
Right 956021199 3:64934952-64934974 CCTTGTCTGGAGGCAAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956021199 Original CRISPR CCTTGTCTGGAGGCAAAGGA TGG Intergenic
No off target data available for this crispr