ID: 956021475

View in Genome Browser
Species Human (GRCh38)
Location 3:64937921-64937943
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956021475_956021485 21 Left 956021475 3:64937921-64937943 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 956021485 3:64937965-64937987 CTACCGCTCTCAACCAAGGCAGG No data
956021475_956021481 -8 Left 956021475 3:64937921-64937943 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 956021481 3:64937936-64937958 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
956021475_956021483 17 Left 956021475 3:64937921-64937943 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 956021483 3:64937961-64937983 TGACCTACCGCTCTCAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956021475 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr