ID: 956030312

View in Genome Browser
Species Human (GRCh38)
Location 3:65030198-65030220
Sequence AGAGCTGTGCAAAGGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956030308_956030312 18 Left 956030308 3:65030157-65030179 CCAGAGAAGGAGAAGAAGGAGAA No data
Right 956030312 3:65030198-65030220 AGAGCTGTGCAAAGGCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956030312 Original CRISPR AGAGCTGTGCAAAGGCCCTG TGG Intergenic
No off target data available for this crispr