ID: 956030413

View in Genome Browser
Species Human (GRCh38)
Location 3:65031057-65031079
Sequence ATATATACTCAGATGACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956030413_956030417 0 Left 956030413 3:65031057-65031079 CCATGAGTCATCTGAGTATATAT No data
Right 956030417 3:65031080-65031102 GCAACTTGAAACCACAGGGGTGG No data
956030413_956030416 -3 Left 956030413 3:65031057-65031079 CCATGAGTCATCTGAGTATATAT No data
Right 956030416 3:65031077-65031099 TATGCAACTTGAAACCACAGGGG No data
956030413_956030419 13 Left 956030413 3:65031057-65031079 CCATGAGTCATCTGAGTATATAT No data
Right 956030419 3:65031093-65031115 ACAGGGGTGGATGAGATCACTGG No data
956030413_956030415 -4 Left 956030413 3:65031057-65031079 CCATGAGTCATCTGAGTATATAT No data
Right 956030415 3:65031076-65031098 ATATGCAACTTGAAACCACAGGG No data
956030413_956030414 -5 Left 956030413 3:65031057-65031079 CCATGAGTCATCTGAGTATATAT No data
Right 956030414 3:65031075-65031097 TATATGCAACTTGAAACCACAGG No data
956030413_956030420 14 Left 956030413 3:65031057-65031079 CCATGAGTCATCTGAGTATATAT No data
Right 956030420 3:65031094-65031116 CAGGGGTGGATGAGATCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956030413 Original CRISPR ATATATACTCAGATGACTCA TGG (reversed) Intergenic
No off target data available for this crispr