ID: 956040422

View in Genome Browser
Species Human (GRCh38)
Location 3:65139519-65139541
Sequence CTCCAGTAGCTGTCAGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956040422_956040429 24 Left 956040422 3:65139519-65139541 CCCAACCCTGACAGCTACTGGAG No data
Right 956040429 3:65139566-65139588 TGTCAGGAAAAAAAATACAAAGG No data
956040422_956040428 8 Left 956040422 3:65139519-65139541 CCCAACCCTGACAGCTACTGGAG No data
Right 956040428 3:65139550-65139572 GGAGATTAGATGAAAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956040422 Original CRISPR CTCCAGTAGCTGTCAGGGTT GGG (reversed) Intergenic
No off target data available for this crispr