ID: 956042224

View in Genome Browser
Species Human (GRCh38)
Location 3:65156478-65156500
Sequence CAGGACTCTATTGGTCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956042221_956042224 5 Left 956042221 3:65156450-65156472 CCTTGGAAGTCACACACAGTCAT No data
Right 956042224 3:65156478-65156500 CAGGACTCTATTGGTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956042224 Original CRISPR CAGGACTCTATTGGTCAAAC AGG Intergenic
No off target data available for this crispr