ID: 956048872

View in Genome Browser
Species Human (GRCh38)
Location 3:65225780-65225802
Sequence CCAGTTTGGAAGCAGAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956048872_956048875 7 Left 956048872 3:65225780-65225802 CCAGGGTTCTGCTTCCAAACTGG No data
Right 956048875 3:65225810-65225832 CTCTGAATTCAAACTCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956048872 Original CRISPR CCAGTTTGGAAGCAGAACCC TGG (reversed) Intergenic
No off target data available for this crispr